Skip to content

Heniochus diphreutes — Details

Bannerfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Occur primarily along outer reef slopes, in current channels. Juveniles in aggregations around isolated patch reefs, adults in large schools well above the bottom (Ref. 9710). In Indonesia, adults most common in depth 40-50 m, reported to 200 m (Ref. 48636). Benthopelagic (Ref. 58302). Feed on plankton. Juveniles may act as cleaners (Ref. 9710); also observed in adults (Ref. 48636). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Range Description

Learn more about this article

This species is widely distributed throughout the Indo-Pacific, from the Red Sea and coast of East Africa in the west to the western Pacific rim in the east, recorded from southern Japan in the north to New South Wales (Australia) and the Kermadec Islands (New Zealand) in the south (G.R. Allen pers. comm. 2006). Also found at the Hawaiian Islands (USA) and the Solomon Islands (G.R. Allen pers. comm. 2006). It has been recorded between depths of 5-210 m, but is usually found below 15 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Learn more about this article

Mauritius, New Zealand Exclusive Economic Zone, Red Sea, Reunion, South Africa (country)

Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6091
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Indo-Pacific: Red Sea and South Africa to warm-temperate Australia and the Hawaiian Islands.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 23 - 25; Analspines: 3; Analsoft rays: 17 - 19

Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334) http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Size

Learn more about this article

Maximum size: 180 mm NG

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

21.0 cm TL (male/unsexed; (Ref. 48636))

Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 2. Fusiliers - Dragonets, Caesionidae - Callionymidae. Zoonetics, Australia. 304-622 p. (Ref. 48636) http://www.fishbase.org/references/FBRefSummary.php?id=48636&speccode=25049

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Diagnostic Description

Learn more about this article

Body is white with two broad oblique dark-brown bands running across the body from the dorsal fin to the abdomen and anal fin. A short brown band runs from the top of the head to the eye. The soft portion of the dorsal fin and the caudal fin are yellow.

Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334) http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology

This species is generally encountered on deep outer reef slopes, with populations inhabiting shallower water in cool upwelling areas in the tropics. Both adults and juveniles are usually encountered in aggregations (G.R. Allen pers. comm. 2006). Animals swim up to several meters off the bottom while feeding on zooplankton. The juveniles have been observed cleaning parasites from other fishes (G.R. Allen pers. comm. 2006).

Systems

Marine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Habitat

Learn more about this article

Known from seamounts and knolls

Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication. http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Depth range based on 187 specimens in 1 taxon.
Water temperature and chemistry ranges based on 103 samples.

Environmental ranges
  Depth range (m): 3 - 124
  Temperature range (°C): 21.733 - 27.844
  Nitrate (umol/L): 0.019 - 6.383
  Salinity (PPS): 34.546 - 35.173
  Oxygen (ml/l): 3.677 - 4.838
  Phosphate (umol/l): 0.118 - 0.557
  Silicate (umol/l): 0.803 - 10.649

Graphical representation

Depth range (m): 3 - 124

Temperature range (°C): 21.733 - 27.844

Nitrate (umol/L): 0.019 - 6.383

Salinity (PPS): 34.546 - 35.173

Oxygen (ml/l): 3.677 - 4.838

Phosphate (umol/l): 0.118 - 0.557

Silicate (umol/l): 0.803 - 10.649

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Depth: 15 - 210m.
From 15 to 210 meters.

Habitat: reef-associated. Occurs primarily along outer reef slopes. Juveniles in aggregations around isolated patch reefs, adults in large schools well above the bottom (Ref. 9710). Feeds on plankton. Juveniles may act as cleaners (Ref. 9710).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Environment

Learn more about this article

reef-associated; non-migratory; marine; depth range 15 - 210 m (Ref. 9710)

Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710) http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs inshore (Ref. 75154).

Randall, J.E. 1985 Guide to Hawaiian reef fishes. Harrowood Books, Newtown Square, PA 19073, USA. 74 p. (Ref. 3921) http://www.fishbase.org/references/FBRefSummary.php?id=3921&speccode=6021

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Form pairs during breeding (Ref. 205).

Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205) http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heniochus diphreutes

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC4948-08|AP006005|Heniochus diphreutes| ACCCGCTGATTATTCTCCACCAATCATAAAGATATCGGCACCCTTTACCTAGTATTTGGTGCTTGGGCCGGGATAGTAGGCACAGCTCTA---AGCCTTCTAATCCGAGCAGAGCTCAGCCAACCTGGCTCCCTTCTAGGGGAC---GACCAGATCTATAATGTTATCGTAACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCTATCATAATTGGGGGTTTTGGTAACTGACTTATCCCTCTAATA---ATTGGGGCCCCAGATATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCTTCCTTCTTCTGGCCTCCTCCGGCGTTGAGGCAGGAGCCGGCACTGGATGAACAGTCTACCCCCCACTAGCCGGTAACCTCGCGCACGCAGGGGCATCAGTTGACCTA---ACTATCTTCTCCCTTCATCTGGCAGGTGTCTCTTCAATTCTAGGAGCTATTAACTTCATCACTACAATCATTAACATGAAACCCCCTGCTATAACTCAATACCAAACTCCTCTTTTCGTATGATCCGTCCTAATTACTGCCGTCCTACTTCTCTTATCCCTTCCCGTGCTTGCCGCT---GGAATCACAATACTACTCACAGACCGAAATCTAAATACAACTTTCTTCGACCCTGCAGGGGGAGGAGACCCTATTCTGTACCAACACTTGTTCTGATTCTTTGGGCACCCAGAAGTCTACATCCTAATCCTCCCTGGGTTTGGAATAATCTCTCACATTGTTGCCTATTACTCTGGCAAAAAA---GAACCTTTTGGCTATATAGGCATGGTTTGAGCTATGATAGCAATCGGCCTTCTAGGGTTTATTGTATGAGCCCACCATATGTTTACAGTTGGAATGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Heniochus diphreutes

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Species: 14
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Rocha, L.A., Pyle, R., Myers, R., Craig, M.T., Pratchett, M. & Carpenter, K.E.

Reviewer/s

Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large overall population, it occurs in a number of protected areas, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trends

Population

Learn more about this article

Population

This species in common, and most abundant in sub-tropical localities (G.R. Allen pers. comm. 2006). There are have been localized declines in the Philippines (K.Carpenter pers. comm. 2009).

Population Trend

Stable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats

There appear to be no major threats to this species (G.R. Allen pers. comm. 2006). There is some localized threat from the aquarium trade in the Philippines (K.Carpenter pers. comm 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is believed to be present within several marine protected areas. Monitoring of the population and collection levels are recommended.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: of no interest; aquarium: commercial

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358) http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Schooling bannerfish

Learn more about this article

Schooling on a wreck, Taba.

The schooling bannerfish, or false moorish idol, is a marine fish native to areas near Africa, that is sometimes traded, in aquaria, as a less expensive alternative to actual moorish idols.

Contents

1 Description
2 Habitat
3 Distribution
4 In the Aquarium
5 References

Description

White with 2 broad diagonal black bands, up to 7 inches (18cm) in length. Similar in appearance to Heniochus acuminatus but has larger eye and smaller snout.^[1] Dramatically similar to actual moorish idols, these fish are only distantly related, and appear to only have convergently evolved the same traits.

Habitat

In schools, juveniles on isolated coral heads or patch reefs, adults in midwater.

Distribution

Red Sea and South Africa to warm-temperate Australia and the Hawaiian Islands.^[2]

A comparison of the three remarkably similar fish, the moorish idol (left), schooling bannerfish (top), and pennant coralfish(bottom)

In the Aquarium

Thrives best in moderate reef tanks of 25-26 degrees celsius. They will usually feed on plankton and brine shrimp, although if underfed they might nip at invertebrates.

References

^ Lieske, E. and Myers, R.F. (2004) Coral reef guide; Red Sea London, HarperCollins ISBN 0-00-715986-2
^ Froese, Rainer, and Daniel Pauly, eds. (2007). "Heniochus diphreutes" in FishBase. 5 2007 version.

This Chaetodontidae article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!