Overview

Comprehensive Description

Biology

Found in most coral reef habitats except in the surge zone (Ref. 9710). Benthopelagic (Ref. 58302). Obligate cleaner (Ref. 9710), picks parasitic crustaceans from other fishes. Monogamous (Ref. 52884). Swims with a dancing-flitting motion. It spends the night resting in a balloon-like mucous cocoon.
  • Tinker, S.W. 1978 Fishes of Hawaii, a handbook of the marine fishes of Hawaii and the Central Pacific Ocean. Hawaiian Service Inc., Honolulu. 568 p. (Ref. 583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Labroides phthirophagus is found in the east central Pacific, along the Hawaiian Islands chain and at Johnston Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Central Pacific: Hawaiian Islands (Ref. 583) and Johnston Islands (Ref. 28618).
  • Tinker, S.W. 1978 Fishes of Hawaii, a handbook of the marine fishes of Hawaii and the Central Pacific Ocean. Hawaiian Service Inc., Honolulu. 568 p. (Ref. 583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 583))
  • Tinker, S.W. 1978 Fishes of Hawaii, a handbook of the marine fishes of Hawaii and the Central Pacific Ocean. Hawaiian Service Inc., Honolulu. 568 p. (Ref. 583)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Labroides phthirophagus
Catalog Number: USNM 164468
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Gosline
Year Collected: 1953
Locality: Hawaii, Oahu, Nr. Diamond Head, Rotenone, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Labroides phthirophagus
Catalog Number: USNM 164467
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Gosline
Year Collected: 1951
Locality: Hawaii, Oahu, Diamond Head, Rotenone, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Labroides phthirophagus
Catalog Number: USNM 164466
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1955
Locality: Hawaii, Honolulu, 100 Yds Off Shore of Waikiki Branch of Hawaii Marine Lab., 7 Ft Depth, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Labroides phthirophagus
Catalog Number: USNM 164469
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1954
Locality: Hawaii: Hawaii, Kealakekua Bay, Speared., Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Labroides phthirophagus inhabits coral and rocky reef habitats, other than within the surge zone (Lieske and Myers 1994). This species is an obligate cleaner, feeding on the crustacean ectoparasites of other fishes, probably including gnathiid isopods (see Grutter 1997 for L. dimidiatus), and also on fish mucus (Masuda and Allen 1993). This species is active in the daytime, and may possibly produce a protective mucous cocoon at night (Tinker 1978).

There is no information regarding sex reversal or hermaphroditism in this species, though it may be similar to L. dimidiatus in these respects (see Robertson 1972; Kuwamura et al. 2002; Sadovy and Liu 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 0 - 90 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 3.66 - 6.5
  Temperature range (°C): 24.610 - 25.104
  Nitrate (umol/L): 0.006 - 0.067
  Salinity (PPS): 34.930 - 35.294
  Oxygen (ml/l): 4.799 - 4.835
  Phosphate (umol/l): 0.092 - 0.114
  Silicate (umol/l): 1.304 - 1.498

Graphical representation

Depth range (m): 3.66 - 6.5

Temperature range (°C): 24.610 - 25.104

Nitrate (umol/L): 0.006 - 0.067

Salinity (PPS): 34.930 - 35.294

Oxygen (ml/l): 4.799 - 4.835

Phosphate (umol/l): 0.092 - 0.114

Silicate (umol/l): 1.304 - 1.498
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 90m.
Recorded at 90 meters.

Habitat: reef-associated. Found in most coral reef habitats except in the surge zone (Ref. 9710). Obligate cleaner (Ref. 9710), picks parasitic crustaceans from other fishes. Swims with a dancing-flitting motion. It spends the night resting in a balloon-like mucous cocoon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in most coral reef habitats except in the surge zone (Ref. 9710). Obligate cleaner (Ref. 9710), picks parasitic crustaceans from other fishes. The surface mucus of host fishes appears to represent a stable food resource for cleaner fishes like Labroides phthirophagus. It is likely that host surface mucus provides cleaners with a reliable energy source in the form of carbohydrates while ectoparasites represent a less stable protein source (Ref. 35736).
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labroides phthirophagus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTGCCTGAGCCGGCATGGTGGGAACGGCCTTGAGCCTACTCATCCGAGCTGAACTAAGCCAACCCGGCGCTCTCCTTGGAGAT---GATCAAATCTACAACGTAATCGTTACAGCCCATGCGTTCGTAATGATCTTCTTTATAGTAATACCAATTATGATTGGGGGCTTCGGAAACTGGCTTATTCCCTTAATAATTGGAGCCCCTGACATGGCCTTTCCTCGAATAAACAATATGAGCTTTTGACTTCTACCGCCATCTTTCCTGCTTCTTCTTGCTTCCTCTGGTGTTGAGTCAGGGGCTGGAACTGGTTGAACAGTCTATCCTCCCCTATCTGGAAATTTGGCCCACGCGGGAGCTTCTGTTGATCTTACTATTTTTTCCCTCCACCTCGCCGGTATTTCATCCATCCTTGGGGCCATTAATTTCATTACAACTATTATTAATATGAAACCCCCTGCCATCTCCCAATATCAAACACCCCTATTTGTCTGAGCTGTACTAATTACAGCGGTTCTTCTTCTACTTTCCCTTCCGGTCCTTGCCGCTGGCATTACAATGCTCCTAACAGACCGAAATCTTAATACCACCTTCTTTGACCCTGCGGGAGGAGGGGATCCTATTTTATATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labroides phthirophagus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G.R., Craig, M., Pollard, D., Rocha, L. & Sadovy, Y.J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Labroides phthirophagus has been assessed as Least Concern. This species has a restricted distribution (found only in the Hawaiian Islands), and there is little known on the status of its populations. Although it is occasionally collected for the marine aquarium fish trade, two thirds of this species range falls within a marine protected area. This species is not thought to be undergoing a significant population decline at the present time.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Little or nothing is known about the status of the populations of Labroides phthirophagus, though it is considered to be relatively common within its relatively restricted distribution range (M. Craig, and L. Rocha, pers. comm. 2009; G. Allen, pers. comm. 2010).
Craig (2010) observed no decline in this species population around the Island of Oahu over the time period of 2002-2004 (M. Craig pers. comm.2010).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats impacting Labroides phthirophagus. However, it is occasionally taken in the marine aquarium fish trade. Also, coral habitat degradation may have some localised impacts on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Labroides phthirophagus. However, 80 % of this species range is within the Papahanaumokuakea Marine National Monument, a well protected marine park in the Northern Hawaiian Islands (L. Rocha pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!