Overview

Comprehensive Description

Biology

Inhabits silty or sandy areas of lagoons and bays (Ref. 9710, 48637). Usually in pairs and lives in a burrow under rocks. Commonly seen in aggregations over large areas in lagoons of atolls. Monogamous (Ref. 52884).
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea, Persian Gulf and East Africa to Samoa; north to Yaeyama Islands, Ryukyu Islands, south to Queensland, Australia.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Samoa and Tonga, north to Yaeyama and Ryukyu islands, south to Western Australia and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 11 - 13
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by pale grey body color with faint pinkish stripe along lower side; cheek with blue to white spots; first dorsal fin with black tip; absence of filamentous dorsal spines; pointed caudal fin, longer in male, 2.9-3.6 in SL; longitudinal scale series 71-99; ctenoid body scales, becoming cycloid anterior to line from upper pectoral fin base to first dorsal fin origin and on abdomen; head or midline of nape without scales; side of nape with scales extending forward short distance anterior to gill opening; partly or fully scaled prepelvic area; depth of body 5.1-6.5 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits areas with fine, silty, coralline sands. Usually in pairs and live in a burrow under rocks. Commonly seen in aggregations over large areas in lagoons of atolls.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 25 m (Ref. 89908)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 121 specimens in 1 taxon.
Water temperature and chemistry ranges based on 90 samples.

Environmental ranges
  Depth range (m): 0.2 - 150
  Temperature range (°C): 26.159 - 29.336
  Nitrate (umol/L): 0.050 - 0.862
  Salinity (PPS): 32.200 - 37.566
  Oxygen (ml/l): 4.314 - 4.725
  Phosphate (umol/l): 0.108 - 0.339
  Silicate (umol/l): 1.141 - 4.752

Graphical representation

Depth range (m): 0.2 - 150

Temperature range (°C): 26.159 - 29.336

Nitrate (umol/L): 0.050 - 0.862

Salinity (PPS): 32.200 - 37.566

Oxygen (ml/l): 4.314 - 4.725

Phosphate (umol/l): 0.108 - 0.339

Silicate (umol/l): 1.141 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 10m.
From 1 to 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits silty or sandy areas of lagoons and bays (Ref. 9710). Usually in pairs and lives in a burrow under rocks. Commonly seen in aggregations over large areas in lagoons of atolls.
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea sexguttata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCCGGGATGATTGGTACTGCACTAAGCCTACTAATCCGAGCCGAACTAAGCCAGCCCGGGGCACTGCTTGGTGACGACCAGATTTACAACGTAATCGTTACTGCCCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTGATTCCTCTAATGATCGGCGCCCCAGATATGGCTTTCCCCCGAATAAATAACATAAGCTTCTGGCTCCTACCCCCATCCTTCCTACTGTTGCTAGCTTCTTCTGGAGTTGAAGCAGGGGCTGGCACTGGTTGAACGGTATACCCCCCTCTAGCAGGAAACCTGGCGCATGCCGGAGCATCTGTAGACTTAACAATTTTCTCCCTTCATCTGGCAGGAATCTCGTCAATCCTCGGTGCAATTAATTTTATTACAACCATTTTGAATATGAAACCCCCAGCCATCTCCCAGTACCAAACACCCCTGTTTGTATGAGCAGTCCTAATTACTGCTGTCCTACTTCTTCTCTCCCTCCCTGTCCTTGCTGCAGGCATCACAATGCTCCTTACTGATCGAAACCTAAACACCACATTCTTTGATCCTGCCGGAGGTGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea sexguttata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Valenciennea sexguttata

Valencienna sexguttata, the Sixspot goby, is a species of goby native to the Indian Ocean and the western Pacific Ocean. It inhabits bays or lagoons in waters of from 3 to 25 metres (9.8 to 82 ft) with silt or sand substrates with larger pieces of rock under which to burrow. This species can reach a length of 14 centimetres (5.5 in) TL. It can also be found in the aquarium trade.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Valenciennea sexguttata" in FishBase. June 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!