Overview
Comprehensive Description
Biology
Inhabits shallow coastal sand and rubble flats, often near mangroves (Ref. 48637). Occur in areas of fine sand in shallow lagoon reefs. Adults occur in pairs while juveniles were often seen in small groups. Feed on small invertebrates by sifting mouthfuls of sand. Monogamous (Ref. 52884). Oviparous (Ref. 205). Breeding pairs are commonly found sharing a single burrow (Ref. 56281).
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
Trusted
Distribution
Indo-West Pacific: widely distributed in the eastern Indian Ocean and western tropical Pacific.
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
Trusted
Physical Description
Morphology
Dorsal spines (total): 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
16.0 cm SL (male/unsexed; (Ref. 48637)); max. reported age: 1 years (Ref. 56281)
-
Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
http://www.fishbase.org/references/FBRefSummary.php?id=48637&speccode=4748
-
Pratchett, M.S., O.A. Pradjakusuma and G.P. Jones 2006 Is there a reproductive basis to solitary living versus pair-formation in coral reef fishes?. Coral Reefs 25:85-92. (Ref. 56281)
http://www.fishbase.org/references/FBRefSummary.php?id=56281&speccode=5566
Trusted
Diagnostic Description
Has 2 to 3 blue-bordered red longitudinal stripes on the head that extends faintly on the body, as well as red basal stripes on the dorsal and anal fins, a dark tip on the first dorsal fin, and red ocelli on the caudal fin.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Ecology
Habitat
Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.
Environmental ranges
Depth range (m): 0.1 - 12
Temperature range (°C): 28.049 - 29.325
Nitrate (umol/L): 0.000 - 1.204
Salinity (PPS): 30.220 - 34.625
Oxygen (ml/l): 4.349 - 4.641
Phosphate (umol/l): 0.108 - 0.351
Silicate (umol/l): 1.305 - 8.403
Graphical representation
Depth range (m): 0.1 - 12
Temperature range (°C): 28.049 - 29.325
Nitrate (umol/L): 0.000 - 1.204
Salinity (PPS): 30.220 - 34.625
Oxygen (ml/l): 4.349 - 4.641
Phosphate (umol/l): 0.108 - 0.351
Silicate (umol/l): 1.305 - 8.403
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 33 samples.
Environmental ranges
Depth range (m): 0.1 - 12
Temperature range (°C): 28.049 - 29.325
Nitrate (umol/L): 0.000 - 1.204
Salinity (PPS): 30.220 - 34.625
Oxygen (ml/l): 4.349 - 4.641
Phosphate (umol/l): 0.108 - 0.351
Silicate (umol/l): 1.305 - 8.403
Graphical representation
Depth range (m): 0.1 - 12
Temperature range (°C): 28.049 - 29.325
Nitrate (umol/L): 0.000 - 1.204
Salinity (PPS): 30.220 - 34.625
Oxygen (ml/l): 4.349 - 4.641
Phosphate (umol/l): 0.108 - 0.351
Silicate (umol/l): 1.305 - 8.403
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 1 - 15m.
From 1 to 15 meters.
Habitat: reef-associated.
From 1 to 15 meters.
Habitat: reef-associated.
Trusted
Trophic Strategy
Occurs in areas of fine sand in shallow lagoon reefs. Adults occur in pairs while juveniles were often seen in small groups. Feeds on small invertebrates by sifting mouthfuls of sand.
-
Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
http://www.fishbase.org/references/FBRefSummary.php?id=8527&speccode=12606
Trusted
Life History and Behavior
Life Cycle
Pairs form upon maturation for breeding purposes (Ref. 56281).
-
Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Valenciennea muralis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGCACTGCACTAAGTCTTCTCATTCGAGCCGAGCTAAGCCAACCTGGGGCACTGCTCGGTGACGACCAGATTTACAACGTAATTGTTACCGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATGATTGGAGCCCCAGACATGGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCTCCCTCTTTCCTTCTACTATTAGCTTCCTCCGGAGTTGAAGCAGGGGCAGGAACAGGATGAACTGTATATCCCCCTCTAGCGGGAAACCTGGCCCACGCCGGAGCTTCCGTAGATTTAACAATTTTTTCCCTTCATTTAGCAGGAATTTCGTCAATCCTAGGAGCAATTAACTTTATTACAACCATCCTAAATATAAAACCCCCTGCTATTTCGCAGTACCAAACCCCACTATTTGTGTGAGCAGTACTAATTACAGCCGTCCTGCTTCTTCTTTCACTCCCAGTACTTGCCGCAGGCATTACAATGCTTCTTACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCAGGAGGAGGGGACCCAATCCTCTATCAACATCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Valenciennea muralis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
http://www.fishbase.org/references/FBRefSummary.php?id=9210
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


