Overview

Comprehensive Description

Biology

Inhabits shallow coastal sand and rubble flats, often near mangroves (Ref. 48637). Occur in areas of fine sand in shallow lagoon reefs. Adults occur in pairs while juveniles were often seen in small groups. Feed on small invertebrates by sifting mouthfuls of sand. Monogamous (Ref. 52884). Oviparous (Ref. 205). Breeding pairs are commonly found sharing a single burrow (Ref. 56281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: widely distributed in the eastern Indian Ocean and western tropical Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 48637)); max. reported age: 1 years (Ref. 56281)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Has 2 to 3 blue-bordered red longitudinal stripes on the head that extends faintly on the body, as well as red basal stripes on the dorsal and anal fins, a dark tip on the first dorsal fin, and red ocelli on the caudal fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 15 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 0.1 - 12
  Temperature range (°C): 28.049 - 29.325
  Nitrate (umol/L): 0.000 - 1.204
  Salinity (PPS): 30.220 - 34.625
  Oxygen (ml/l): 4.349 - 4.641
  Phosphate (umol/l): 0.108 - 0.351
  Silicate (umol/l): 1.305 - 8.403

Graphical representation

Depth range (m): 0.1 - 12

Temperature range (°C): 28.049 - 29.325

Nitrate (umol/L): 0.000 - 1.204

Salinity (PPS): 30.220 - 34.625

Oxygen (ml/l): 4.349 - 4.641

Phosphate (umol/l): 0.108 - 0.351

Silicate (umol/l): 1.305 - 8.403
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in areas of fine sand in shallow lagoon reefs. Adults occur in pairs while juveniles were often seen in small groups. Feeds on small invertebrates by sifting mouthfuls of sand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pairs form upon maturation for breeding purposes (Ref. 56281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea muralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGCACTGCACTAAGTCTTCTCATTCGAGCCGAGCTAAGCCAACCTGGGGCACTGCTCGGTGACGACCAGATTTACAACGTAATTGTTACCGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATGATTGGAGCCCCAGACATGGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCTCCCTCTTTCCTTCTACTATTAGCTTCCTCCGGAGTTGAAGCAGGGGCAGGAACAGGATGAACTGTATATCCCCCTCTAGCGGGAAACCTGGCCCACGCCGGAGCTTCCGTAGATTTAACAATTTTTTCCCTTCATTTAGCAGGAATTTCGTCAATCCTAGGAGCAATTAACTTTATTACAACCATCCTAAATATAAAACCCCCTGCTATTTCGCAGTACCAAACCCCACTATTTGTGTGAGCAGTACTAATTACAGCCGTCCTGCTTCTTCTTTCACTCCCAGTACTTGCCGCAGGCATTACAATGCTTCTTACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCAGGAGGAGGGGACCCAATCCTCTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea muralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!