Overview

Comprehensive Description

Biology

Inhabits shallow coastal sand and rubble flats, often near mangroves (Ref. 48637). Occur in areas of fine sand in shallow lagoon reefs. Adults occur in pairs while juveniles were often seen in small groups. Feed on small invertebrates by sifting mouthfuls of sand. Monogamous (Ref. 52884). Oviparous (Ref. 205). Breeding pairs are commonly found sharing a single burrow (Ref. 56281).
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: widely distributed in the eastern Indian Ocean and western tropical Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 48637)); max. reported age: 1 years (Ref. 56281)
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
  • Pratchett, M.S., O.A. Pradjakusuma and G.P. Jones 2006 Is there a reproductive basis to solitary living versus pair-formation in coral reef fishes?. Coral Reefs 25:85-92. (Ref. 56281)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Has 2 to 3 blue-bordered red longitudinal stripes on the head that extends faintly on the body, as well as red basal stripes on the dorsal and anal fins, a dark tip on the first dorsal fin, and red ocelli on the caudal fin; characterized further by pale grey body color on back, grading to white on lower side; without filamentous dorsal spines; rhomboid caudal fin, longer than head; length of caudal fin 2.8-3.5 in SL; longitudinal scale series 73-94; ctenoid body scales, becoming cycloid anteriorly below anterior part of fist of first dorsal fin; head or midline of nape without scales; side of nape with scales extending forward above middle to front of operculum; base of pectoral fin scaleless; usually partly scaled prepelvic area in adult; depth of body 5.1-6.2 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 15 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 0.1 - 12
  Temperature range (°C): 28.049 - 29.325
  Nitrate (umol/L): 0.000 - 1.204
  Salinity (PPS): 30.220 - 34.625
  Oxygen (ml/l): 4.349 - 4.641
  Phosphate (umol/l): 0.108 - 0.351
  Silicate (umol/l): 1.305 - 8.403

Graphical representation

Depth range (m): 0.1 - 12

Temperature range (°C): 28.049 - 29.325

Nitrate (umol/L): 0.000 - 1.204

Salinity (PPS): 30.220 - 34.625

Oxygen (ml/l): 4.349 - 4.641

Phosphate (umol/l): 0.108 - 0.351

Silicate (umol/l): 1.305 - 8.403
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in areas of fine sand in shallow lagoon reefs. Adults occur in pairs while juveniles were often seen in small groups. Feeds on small invertebrates by sifting mouthfuls of sand.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pairs form upon maturation for breeding purposes (Ref. 56281).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea muralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGCACTGCACTAAGTCTTCTCATTCGAGCCGAGCTAAGCCAACCTGGGGCACTGCTCGGTGACGACCAGATTTACAACGTAATTGTTACCGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATGATTGGAGCCCCAGACATGGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTACTCCCTCCCTCTTTCCTTCTACTATTAGCTTCCTCCGGAGTTGAAGCAGGGGCAGGAACAGGATGAACTGTATATCCCCCTCTAGCGGGAAACCTGGCCCACGCCGGAGCTTCCGTAGATTTAACAATTTTTTCCCTTCATTTAGCAGGAATTTCGTCAATCCTAGGAGCAATTAACTTTATTACAACCATCCTAAATATAAAACCCCCTGCTATTTCGCAGTACCAAACCCCACTATTTGTGTGAGCAGTACTAATTACAGCCGTCCTGCTTCTTCTTTCACTCCCAGTACTTGCCGCAGGCATTACAATGCTTCTTACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCAGGAGGAGGGGACCCAATCCTCTATCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea muralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!