Overview

Comprehensive Description

Biology

Occurs in areas of fine sand and shallow lagoon reefs at depths less than 3 m, rarely at depths greater than 6 m. Adults usually in pairs, constructing burrows under rubble. Monogamous (Ref. 52884, 48637). Feeds on small invertebrates (e.g. copepods, amphipods, ostracods, nematodes, and foraminiferans) by sifting mouthfuls of sand.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 12 - 13; Analspines: 1; Analsoft rays: 11 - 13
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm SL (male/unsexed; (Ref. 48637))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by pale grey body color, grading to white ventrally; presence of five, blue-edged bars extending ventrally to middle of side, each bar containing reddish brown to black blotch at bottom; blue bands; spots on head; pectoral fin base with a pair of pink stripes; dorsal fin with narrow pink bands and blue to reddish spots on second dorsal and caudal fins; without dorsal filamentous spines; rhomboid caudal fin, longer than head; length of caudal fin 2.7 in SL; longitudinal scale series 80-121; ctenoid body scales , becoming cycloid anteriorly below first or second dorsal spine; head or midline of nape without scales; side of nape with scales extending forward to above middle of operculum; usually scaled pectoral fin base in adult; partly or fully scaled prepelvic area of adult; depth of body 6.0-6.7 in SL (Ref. 90102).
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 30 m (Ref. 27115), usually ? - 6 m (Ref. 8527)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0.15 - 8.5
  Temperature range (°C): 25.819 - 28.954
  Nitrate (umol/L): 0.094 - 0.423
  Salinity (PPS): 33.507 - 35.347
  Oxygen (ml/l): 4.525 - 4.684
  Phosphate (umol/l): 0.113 - 0.247
  Silicate (umol/l): 0.888 - 3.382

Graphical representation

Depth range (m): 0.15 - 8.5

Temperature range (°C): 25.819 - 28.954

Nitrate (umol/L): 0.094 - 0.423

Salinity (PPS): 33.507 - 35.347

Oxygen (ml/l): 4.525 - 4.684

Phosphate (umol/l): 0.113 - 0.247

Silicate (umol/l): 0.888 - 3.382
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Constructs burrows in the sand (Ref. 6110).
  • Langton, R.W. and R.E. Bowman 1980 Food of fifteen northwest Atlantic Gadiform fishes. NOAA Tech. Rep. NMFS SSRF-740, U.S. Department of Commerce.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

After spawning, a paired female constructs a mound on the burrow made up of dead coral fragments while the male watches over the eggs in the burrow (Ref. 85149). The mound promotes water-exchange in the burrow which helps the male in tending the eggs (Ref. 85149). The amount of female parental investment is displayed by the height of the constructed mound (Ref. 85149). Consequently, larger females build higher mounds which affects male mating preference (Ref. 85149).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea longipinnis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGTGCCTGNGCCGGAATAGTTGGTACTGCACTGAGCCTACTAATTCGAGCCGAGCTCAGCCAACCCGGGGCACTGCTCGGTGACGACCAAATTTACAACGTTATTGTTACTGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCGATCATGATTGGAGGCTTCGGGAACTGACTAATTCCTCTAATGATTGGGGCCCCGGACATGGCCTTTCCTCGGATAAATAATATGAGCTTCTGGCTCCTGCCCCCCTCTTTCCTTCTACTCCTAGCTTCTTCGGGAGTTGAGGCCGGGGCTGGAACAGGGTGAACTGTCTACCCCCCTTTAGCAGGAAACCTGGCCCACGCCGGAGCTTCCGTAGACCTAACCATTTTCTCCCTTCATTTAGCGGGGATTTCATCAATTTTAGGTGCAATCAATTTTATTACAACTATTCTAAATATAAAACCTCCTGCTATTTCACAGTACCAAACTCCACTATTCGTATGAGCAGTCCTAATCACTGCCGTCCTGCTCCTTCTTTCGCTTCCGGTACTTGCCGCGGGCATTACGATGCTTCTTACGGACCGAAACCTTAACACTACTTTCTTTGATCCTGCAGGGGGAGGANACCCAATCCTTTACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea longipinnis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Valenciennea longipinnis

Valenciennea longipinnis, the Long-finned goby, is a species of goby native to the Indian Ocean and the western Pacific Ocean where it can be found in lagoons and areas with substrates of fine sand at depths of mostly less than 3 metres (9.8 ft), occasionally down to 6 metres (20 ft) and rarely deeper than that. This species can reach a length of 18 centimetres (7.1 in) SL. It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.[1]

See also[edit]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Valenciennea longipinnis" in FishBase. June 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!