Overview

Comprehensive Description

Description

 The body is elongate and compressed, the tongue adnate, the head is slightly compressed.The pelvic fins are completely separated, no membrane is present between the first and the second dorsal fins. The first dorsal fin is shallow and its margin rounded, the fourth spine is slightly longer than the other spines, and the caudal fin is deeply emarginate. The specimens have a pair of elongated caudal fin filaments that makes the caudal fin a peculiar shape as typical for the species. Specimens above 70 mm SL show the presence of the elongated caudal fin filaments (Hoese and Larson 1994). Body is covered with ctenoid scales while anteriorly under the middle of the first dorsal fin and on the belly th scale are cycloid; sides of the nape and the pectoral base are scaled; the prepelvic area are naked; the longitudinal-scale count is 142; the transverse-scale count is 40.  Colour. Overall colouration is similar to that described by Hoese and Larson (1994). The top of the head and the dorsal surface of the body are brownish gray; the rest of the head and the body is white to pale gray.  The body has two dark red stripes, the dorsal stripe extending from the front of the snout through the eye and just above the pectoral base and along the upper body to the tip of the upper caudal filament; the ventral stripe runs parallel to the first stripe, beginning at the side of the upper lip, extending across the upper part of the preoperculum and middle of the operculum, over middle of the pectoral base, continuing on the body behind the pectoral base, and reaching the tip of the lower caudal filament.The colour of the stripes is dark red to reddish brown, darkest anteriorly, and the stripes on the caudal filaments are outlined in white. The eye is yellowish white dorsally and ventrally with a reddish brown stripe through the middle, and the lower lip is white. The first dorsal fin possesses a large oval black spot extending between the third and the fifth dorsal spines.  Morphometric and meristic characters of Valenciennea helsdingenii from the Gulf of Mannar, southeast coast of India.
Morphometric measurements GB.31.66.230.1 GB.31.66.230.1.1 mm % SL mm % SL Standard length (SL) 97 − 145 − Head length (HL) 23 23.7 37 25.5 Eye diameter 4 4.1 5 3.4 Postorbital length 12 12.4 19 13.1 Upper jaw length 10 10.3 16 11.0 Lower jaw length 9 9.3 15 10.3 Preorbital length 9 9.3 14 9.7 Predorsal length 32 33.0 48 33.1 Prepectoral length 27 27.8 45 31.0 Prepelvic length 27 27.8 42 29.0 Preanal length 56 57.7 86 59.3 Body depth (max.) 17 17.5 26 17.9 Caudal peduncle length 16 16.5 25 17.2 Caudal peduncle width 11 11.3 15 10.3 Distance between anal fin and anus 2 2.1 4 2.8 Distance between pelvic fin and anal fin 29 29.9 45 31.0 Fin-ray counts First dorsal VI VI Second dorsal I11 I12 Pectoral 22 22 Pelvic 6 6 Anal I11 I12 Segmented caudal 17 17 Branched caudal 13 13
Creative Commons Attribution 3.0 (CC BY 3.0)

© K. Kannan, K. Sureshkumar, L. Ranjith, K. K. Joshi, M. S. Madan, Sajan John

Source: ZooKeys

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A relatively rare species occurring singly but usually in pairs over silty flat sand patches, or rubble substrates; a mound-building species. Usually found on outer reefs at the bottom of coral or rocky drop-offs, rarely in lagoons. Feeds on small burrowing animals by sifting mouthfuls of sand. Monogamous (Ref. 34105, 48637, 52884). Eggs hatched 2 days after spawning in aquaria; 35 days after, the larvae reached 5.25 mm.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, South Africa and Mascarenes east to Line Islands and Marquesas Islands, north to southern Japan, south to New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: southern Red Sea (Ref. 34105) and East Africa (where common, Ref. 9710) to Indonesia, north to southern Japan (Ref. 9710), south to the Great Barrier Reef (Ref. 2334).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 11; Analspines: 1; Analsoft rays: 11
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 9002))
  • Kuiter, R.H. 1993 Coastal fishes of south-eastern Australia. University of Hawaii Press. Honolulu, Hawaii. 437 p. (Ref. 9002)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by pale grey body color with broad white midlateral stripe bordered by pair of black to brownish stripes; first dorsal fin with large black spot; truncate to slightly emarginate caudal fin, ray above and below central three rays prolonged as filament in adult; length of caudal fin 2.4-5.0 in SL; longitudinal scale series 127-146; ctenoid body scales except cycloid on abdomen; head or midline of nape without scales; in adult, cycloid scales extending forward on side of nape to above middle of operculum; base of pectoral fin and prepelvic area scaled in adult; depth of body 5.0 in SL (Ref. 90102).
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A relatively rare species occuring singly but usually in pairs over silty flat sand patches, or rubble substrates. Usually found on outer reefs at the bottom of coral or rocky dropoffs, rarely in lagoons. Feeds on small fossorial animals by sifting mouthfuls of sand. Eggs hatched 2 days after spawning in aquaria; 35 days after, the larvae reached 5.25 mm.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 40m.
From 1 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 45 m (Ref. 48637), usually 1 - 30 m (Ref. 27115)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 15 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding consists of scooping mouthfuls of surface sand, often with a 'chewing' motion, and discarding most of it through the gill openings, presumably retaining the edible material. Rarely are they seen to pick up a small morsel apparently without sand. Individuals of a pair usually scoop sand alternately. When one looked up and released sand, the other scooped up sand (Ref. 34105).
  • Clark, E., M.J. Stoll, T.K. Alburn and R. Petzold 2000 Mound-building and feeding behavior of the twostripe goby, Valenciennea helsdingenii, in the south Red Sea. Environ. Biol. Fish. 57:131-141. (Ref. 34105)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea helsdingenii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCCTGGGCCGGAATAGTGGGCACTGCGTTGAGCCTACTAATTCGAGCCGAACTAAGCCAACCCGGGGCACTCCTCGGCGACGACCAAATCTACAACGTAATCGTTACTGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTAATCCCTCTAATGATTGGAGCCCCTGACATGGCCTTCCCCCGAATAAATAACATAAGCTTTTGACTGCTGCCCCCATCTTTCCTCCTTCTCTTAGCATCTTCTGGAGTAGAAGCTGGAGCTGGGACAGGATGGACTGTATACCCTCCTCTTGCCGGAAACCTAGCGCATGCTGGGGCGTCCGTTGATCTGACAATCTTCTCCCTCCACTTAGCCGGAATTTCCTCAATTCTAGGTGCAATCAATTTCATCACAACTATCTTAAACATGAAACCCCCAGCCATTTCTCAGTACCAGACACCCCTGTTTGTTTGAGCTGTCCTAATTACGGCGGTGCTTCTGCTCCTGTCTCTTCCTGTTCTTGCTGCCGGCATCACAATGCTCCTTACGGACCGAAACCTAAACACCACATTCTTTGACCCGGCAGGAGGAGGAGACCCGATTCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea helsdingenii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Valenciennea helsdingenii

Valenciennea helsdingenii is a species of goby from the Indo-Pacific. It is commonly known as the twostripe goby, black-lined sleeper goby, or railway sleeper goby. It can grow up to a length of 25 cm (9.8 in) and is distinguishable by two prominent orange to black lines running longitudinally through its body.

Taxonomy[edit]

Twostripe gobies were first described by the Dutch ichthyologist Pieter Bleeker in 1858 as Eleotriodes helsdingenii. The type specimens were originally collected from Pulau-Pulau Gorong, Maluku, Indonesia. It belongs to the hover goby genus Valenciennea in the true goby family, Gobiidae.[1]

Description[edit]

The body of twostripe gobies is elongated and laterally compressed.[2] They are commonly 18 cm (7.1 in) in length, with a maximum length of 25 cm (9.8 in).[1][3] The body is predominantly white to pale gray in color, with the dorsal surface a darker brownish gray. It has two prominent orange, dark red, reddish-brown, or black lines running longitudinally on the sides of its body, darkest at the anterior end and growing lighter towards the back. The upper line begins from the front of the snout, goes through the eye, and ends at the tip of the upper fork of the caudal fin. The lower line is parallel to the upper line and begins from the side of the upper lip, through the middle of the base of pectoral fins, and ends at the tip of the lower fork of the caudal fin. Both upper and lower lines are outlined in white at the caudal fin. A large oval black spot is also present between the third and fifth spines of the dorsal fin.[2]

The pelvic fins are completely separated, no membrane is present between the first and the second dorsal fins. The first dorsal fin is shallow and its margin rounded, and the fourth spine is slightly longer than the other spines.[2] The caudal fin in adults is deeply notched with two long filaments. Juveniles have more rounded caudal fins.[1]

Ecology[edit]

Twostripe gobies are relatively rare. They usually occur in pairs, but can be found alone in silty flat sand patches or rubble substrates.[4] They are usually found on outer reefs at the bottom of coral or rocky dropoffs, rarely in lagoons. They feed on small digging (fossorial) organisms by sifting them from mouthfuls of sand.[5]

Eggs hatch two days after spawning and the larvae reach lengths of 5.25 mm (0.207 in) after 35 days.[5] Juveniles are usually found near rocks in clear estuaries.[1]

The fish is carnivore, feeding on small invertebrates.[6]

Distribution[edit]

Twostripe gobies have a wide distribution range. They can be found in the temperate and tropical waters of the Indian Ocean and the western Pacific Ocean. From the coast of East Africa, the southern Red Sea, the Maldives, southeast India and Sri Lanka, Southeast Asia, Australia, western Oceania, and Japan.[1][2]

References[edit]

  1. ^ a b c d e McGrouther, M. (March 14, 2013). "Black-lined Sleeper Goby, Valenciennea helsdingenii (Bleeker, 1858)". Australian Museum. Retrieved August 15, 2013. 
  2. ^ a b c d Kannan, K.; Sureshkumar, K.; Ranjith, L.; Joshi, K.K.; Madan, M.S.; John, S. (2013). "First record of the twostripe goby, Valenciennea helsdingenii (Gobiidae, Gobiiformes) from the southeast coast of India". ZooKeys 323: 91. doi:10.3897/zookeys.323.5440.  edit
  3. ^ Capuli, E.E.; Opitz, S. "Valenciennea helsdingenii (Bleeker, 1858): Twostripe goby". Fishbase. Retrieved August 15, 2013. 
  4. ^ Bray, Dianne. "Blacklined Glidergoby, Valenciennea helsdingenii". Fishes of Australia. Retrieved 15 October 2014. 
  5. ^ a b Bailly, N. (2013). Nicolas Bailly, ed. "Valenciennea helsdingenii (Bleeker, 1858)". FishBase. World Register of Marine Species. Retrieved August 15, 2013. 
  6. ^ Cite error: The named reference fishes was invoked but never defined (see the help page).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Valenciennea helsdingeni

Valenciennea helsdingeni is a Goby from the Indo-West Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 25 cm in length.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!