Overview

Comprehensive Description

Biology

Hides in caves and crevices (Ref. 9710), also among corals or rock. Ranges to at least 70 m. Monogamous (Ref. 52884).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: Seychelles, Comores and Mascarenes east to Fiji and Tonga, north to southern Japan and Ogasawara Islands, south to Western Australia, Elizabeth and Middleton reefs, and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea and East Africa to Tonga (Ref. 10753), north to southern Japan, south to the Great Barrier Reef.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: Seychelles, Comores and Mascarenes east to Fiji and Tonga, north to southern Japan and Ogasawara Islands, south to Western Australia, Elizabeth and Middleton reefs, and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 11; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 70 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 70 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm FL (male/unsexed; (Ref. 5525))
  • Kulbicki, M., G. Mou Tham, P. Thollot and L. Wantiez 1993 Length-weight relationships of fish from the lagoon of New Caledonia. Naga ICLARM Q. 16(2-3):26-29. (Ref. 5525)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by having alternating dark-edged brown and narrower white bars on head and body; dorsal and caudal fins with brown spotting; basal part of dorsal fins with dark spots/bands; longitudinal scale series 27-31; ctenoid scales on body except cycloid on abdomen, prepectoral and prepelvic areas; upper opercle with a patch of cycloid scales; cheek without scales; depth of body 3.8-4.6 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Amblygobius naraharae
Catalog Number: USNM 62239
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): J. Snyder & M. Sindo
Locality: Market At Naha, Okinawa, Japan., Okinawa Prefecture, Japan, Ryukyu Islands, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Amblygobius naraharae
Catalog Number: USNM 74553
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Naha, Okinawa, Japan., Okinawa, Japan, Ryukyu Islands, Pacific
Vessel: Albatross
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 70m.
From 1 to 70 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; brackish; marine; depth range 1 - 70 m (Ref. 2334), usually 1 - 30 m (Ref. 9002)
  • Kuiter, R.H. 1993 Coastal fishes of south-eastern Australia. University of Hawaii Press. Honolulu, Hawaii. 437 p. (Ref. 9002)
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 149 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 0.4575 - 72
  Temperature range (°C): 25.275 - 29.336
  Nitrate (umol/L): 0.047 - 3.114
  Salinity (PPS): 32.200 - 40.307
  Oxygen (ml/l): 3.755 - 4.812
  Phosphate (umol/l): 0.073 - 0.546
  Silicate (umol/l): 0.506 - 7.618

Graphical representation

Depth range (m): 0.4575 - 72

Temperature range (°C): 25.275 - 29.336

Nitrate (umol/L): 0.047 - 3.114

Salinity (PPS): 32.200 - 40.307

Oxygen (ml/l): 3.755 - 4.812

Phosphate (umol/l): 0.073 - 0.546

Silicate (umol/l): 0.506 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 50m.
From 1 to 50 meters.

Habitat: reef-associated. Convict goby.   (Regan, 1908) Attains 6 cm. Yellowish brown with conspicuous dark-edged narrow whitish bars on head and body. Fins yellowish with narrow blue-white margins. Brown spots on dorsal and caudal fins. Lives in rocky crevices and caves and is rarely observed. Indo-West Pacific, Japan, Australia, Marianas south to East Africa down to Natal in South Africa. Found primarily in shallow water, depth less than 50 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs among corals or rock.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Benthic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Priolepis cincta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Priolepis cinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTTTATCTTGTATTTGGTGCCTGAGCCGGGATAGTTGGAACCGCCCTCAGCCTCCTAATTCGGGCTGAACTTAGCCAGCCCGGCGCTCTACTTGGGGACGATCAGATTTACAATGTGATTGTAACCGCTCATGCTTTCGTAATAATTTTTTTTATGGTCATACCTATTATGATCGGGGGTTTCGGAAACTGACTAGTACCACTTATAATTGGTGCCCCTGACATGGCTTTCCCCCGAATAAATAACATAAGCTTCTGGCTTCTCCCCCCCTCCTTTTTGCTTCTTCTAGCATCCTCTGGCGTAGAAGCAGGGGCAGGAACAGGATGAACAGTTTATCCCCCGTTGGCCAGCAACCTAGCCCACGCAGGGGCCTCTGTAGATTTAACAATTTTTTCTCTTCACTTAGCTGGAATTTCCTCTATCCTAGGGGCAATCAATTTTATTACTACAATCTTAAATATGAAACCCCCCTCAATTTCGCAATACCAGACCCCCCTTTTCGTTTGGGCGGTCTTAATTACTGCCGTCCTTCTTCTCCTCTCCCTCCCAGTTCTCGCAGCTGGCATTACAATGCTTCTAACAGACCGAAATTTAAATACTACATTCTTTGACCCTGCTGGAGGAGGGGACCCAATTCTTTATCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Priolepis cinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Priolepis cincta

Priolepis cincta, commonly known as the Girdled goby is a species of goby fish described by Regan in 1908.[1]

Distribution[edit]

It's distributional range extends from the Red Sea to Tonga, then from Japan to the Great Barrier Reef.[2] It can be found in Brackish water and Salt water, with a depth range of 1 - 70 metres (3 ft - 229 ft), although it is usually seen at depths of 1 - 30 metres (3 ft - 98 ft).[3][4]

Behaviour[edit]

The fish is a benthic spawner.[5] They tend to hide in caves and crevices, and can also be found in corals.[6] It is a Monogamous fish and are an average length of 7 centimetres.[7][8] The species is used in aquarium commercial use by humans.[5]

Etymology[edit]

The name Priolepis is combined from two words from the Greek Language: prio is translated as "to saw" while lepis means "scale". cincta derives from the Latin word cinctum which can translate to either a girdle or bird, which is in reference to its colour pattern.[5]

References[edit]

  1. ^ "Girdled goby - Thai biodiversity". Biodiversity-Base Economy Development :BEDO (Thailand). Retrieved 24 January 2015. 
  2. ^ Winterbottom, Richard; Burridge, Mary (October 1993). "Revision of Indo-Pacific species possessing a reduced transverse pattern of cheek papillae, and predorsal scales (Teleostei; Gobiidae)". Canadian Journal of Zoology 71 (10): 2056–2076. doi:10.1139/z93-291. 
  3. ^ Steene, John E. Randall, Gerald R. Allen, Roger C. (1997). Fishes of the Great Barrier Reef and Coral Sea (Rev. and expanded ed. ed.). Honolulu: University of Hawaii Press. p. 506. ISBN 978-0824818951. 
  4. ^ Kuiter, Rudie H. (1993). Coastal fishes of south-eastern Australia. Honolulu: Univ. of Hawaii Press u.a. p. 437. ISBN 978-0824815233. 
  5. ^ a b c "Priolepis cincta (Regan, 1908)". FishBase - Academia Sinica. Retrieved 24 January 2015. 
  6. ^ Myers, Ewald Lieske ; Robert (1996). Coral reef fishes : Caribbean, Indian Ocean and Pacific Ocean ; including the Red Sea (1. ed., repr. with corr. ed.). London [u.a.]: HarperCollins. p. 400. ISBN 978-0002199742. 
  7. ^ Whiteman, EA; Côte, IM (May 2004). "Monogamy in marine fishes.". Biological reviews of the Cambridge Philosophical Society 79 (2): 351–75. PMID 15191228. 
  8. ^ Kulbicki, M.; Mou Tham, G.; Thollot, P.; Wantiez, L. (1993). "Length-weight relationships of fish from the lagoon of New Caledonia". Naga, the ICLARM Quarterly 16 (2-3): 26–30. ISSN 0116-290X. Retrieved 24 January 2015. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!