Overview

Brief Summary

Dixson and Hay (2012) documented a remarkable mutualistic relationship between the staghorn coral Acropora nasuta and the Redhead Goby (Paragobidon enchinocephalus), which is recruited by the coral to keep it free of Turtleweed (Chlorodesmis fastigiata). Within minutes of Turtleweed (or even a chemical extract from the Turtleweed) contacting the coral, the coral releases an odor that recruits gobies to trim the Turtleweed and dramatically reduce coral damage that would otherwise occur. Interestingly, in contrast to the other goby species shown to play a similar role (the Broad-barred Goby, Gobiodon histrio) the Redhead Goby does not consume the Turtleweed it removes.

  • Dixson, D.L. and M.E. Hay. 2012. Corals chemically cue mutualistic fishes to remove competing seaweeds. Science 338: 804-807.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Redhead Goby, Paragobiodon echinocephalus, is a small fish with a black body and fins and a large red-orange head that is covered in soft, short bristles. It is found in coral reefs from the Red Sea and Madagascar in the West to Japan, Polynesia and Australia in the East (Herre 1936, Masuda et al. 1984, Randall et al. 1990, Allen & Adrim 2003).  This goby inhabits live heads of scleractinian corals, in particular, the hood coral, Stylophora pistillata (Kuwamura et al. 1994a, Herler & Hilgers 2005, Belmaker et al. 2007, Herler 2007).  It has also been found in association with the cauliflower coral, Pocillopora damicornis (Lassig 1977) and the small staghorn coral Acropora nasuta (Dixson & Hay 2012).  The fishes rely on their coral host for food, shelter from predation, and breeding sites.

Redhead gobies may live in a coral singly, in pairs, or in groups, with larger coral generally hosting larger groups of fishes.  Within an individual coral, only the largest two fish will breed (Kuwamura et al. 1993).  After the female spawns on the coral, the father will guard the eggs until they hatch (Kuwamura et al. 1993).  

Like many reef fishes, redhead gobies are capabable of changing sex (sequential hermaphroditism). But unlike most sequential hermaphrodites who change sex only once during  their lifetime, P. echinocephalus may change sex repeatedly in either direction (Nakashima et al. 1995).  In fact, the phenomenon of multiple changes from female to male or male to female (serial hermaphroditism) was first described in this species (Kuwamura et al. 1994b). 

  • Allen, G.R. and M. Adrim, 2003. Coral reef fishes of Indonesia. Zool. Stud. 42(1):1-72.
  • Belmaker, J., O. Polak, N. Shashar, Y. Ziv. 2007. Geographic divergence in the relationship between Paragobiodon echinocephalus and its obligate coral host. Journal of Fish Biology 71(5):1555–1561.
  • Dixson, D. L., Hay, M. E. 2012. Corals Chemically Cue Mutualistic Fishes to Remove Competing Seaweeds. Science 338(6108):804-807. DOI: 10.1126/science.1225748
  • Herler, J. 2007. Microhabitats and ecomorphology of coral- and coral rock-associated gobiid fish (Teleostei : Gobiidae) in the northern Red Sea. Marine Ecology 28 Suppl. 1: 82-94.
  • Herler J. & Hilgers H. 2005. A synopsis of coral and coral-rock associated gobies (Pisces: Gobiidae) from the Gulf of Aqaba, northern Red Sea. aqua, Journal of Ichthyology and Aquatic Biology 10(3):103-132.
  • Herre, A. W. 1936. Fishes of the Crane Pacific Expedition. Field Museum of Natural History Zoological series, v. 21, Chicago. http://dx.doi.org/10.5962/bhl.title.2729
  • Kuwamura, T. Yogo, Y., Nakashima, Y. 1993. Size-assortative monogamy and paternal egg care in a coral goby Paragobiodon echinocephalus. Ethology. 95:65–75.
  • Kuwamura, T. Yogo, Y., Nakashima, Y. 1994a. Population dynamics of goby Paragobiodon echinocephalus and host coral Stylophora pistillata. Marine Ecology Progress Series 103:17-23.
  • Kuwamura, T. Yogo, Y., Nakashima, Y. 1994b. Sex change in either direction by growth rate advantage in a monogamous coral goby Paragobiodon echinocephalus . Behav. Ecol. 5: 434–438.
  • Lassig, B. R. 1997. Communication and coexistence in a coral community. Marine Biology 42:85-92.
  • Masuda, H., Amaoka, K. Araga, C., Uyeno,T. , Yoshino, T. 1984. The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press.
  • Nakashima, Y., Kuwamura, T., Yogo, Y. 1995. Why be a both-ways sex changer. Ethology 101: 301-307.
  • Randall, J.E., Allen, G.R. , Steene, R.C. 1990. Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Katja Schulz

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Lives among branches of Stylophora coral. Monogamous (Ref. 52884).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Marquesan and Tuamoto islands, north to the Ryukyu Islands, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: Seychelles, Madagascar and western Mascarenes east to Tuamotu Archipelago and Marquesas Islands, north to Ryukyu Islands, south to Queensland (Australia), New Caledonia, Lord Howe Island, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 8 - 9; Analspines: 1; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 40 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

4.0 cm TL (male/unsexed; (Ref. 4343))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head reddish-orange; body and fins black (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Lives among coral branches @Stylophora mordax@.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 91 specimens in 1 taxon.
Water temperature and chemistry ranges based on 78 samples.

Environmental ranges
  Depth range (m): 0.305 - 42
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.047 - 2.103
  Salinity (PPS): 32.019 - 36.148
  Oxygen (ml/l): 4.135 - 5.079
  Phosphate (umol/l): 0.085 - 0.415
  Silicate (umol/l): 0.667 - 5.552

Graphical representation

Depth range (m): 0.305 - 42

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.047 - 2.103

Salinity (PPS): 32.019 - 36.148

Oxygen (ml/l): 4.135 - 5.079

Phosphate (umol/l): 0.085 - 0.415

Silicate (umol/l): 0.667 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Lives among branches of Stylophora mordax coral.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paragobiodon echinocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNCTTTATCTGGTATTTGGTGCCTGAGCCGGTATAATCGGCACAGCCTTAAGCCTGCTTATTCGGGCTGAGCTCAGCCAACCTGGCGCCCTACTCGGCGACGATCAGATTTATAACGTGATTGTAACTGCTCATGCTTTCGTAATAATCTTCTTTATAGTGATACCAATTATGATTGGAGGATTCGGAAATTGACTGATTCCGCTGATGATTGGTGCCCCTGACATGGCTTTTCCTCGAATAAATAATATAAGCTTCTGACTTCTTCCCCCCTCTTTCCTCCTCCTACTGGCCTCGTCAGGAGTTGAAGCAGGGGCCGGAACAGGATGAACTGTTTACCCCCCCCTAGCTGGAAACCTAGCTCACGCTGGAGCATCCGTTGACTTAACCATTTTTTCACTGCATCTTGCAGGAATCTCCTCTATTCTAGGAGCAATCAACTTCATCACTACAATTCTCAATATAAAACCCCCGGCTGTCTCTCAATACCAAACACCTCTTTTTGTTTGAGCAGTCCCTATTACAGCCGTGCTCTTACTTCTCTCTCTCCCAGTCCTTGCCGCTGGGATCACAATACCTCTCACTGACCGAAACCTAAATACAACCTTCTTTGACCCTGCAGGCGGAGGAGACCCTATTCTTTACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paragobiodon echinocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Research Collection of Slava Ivanenko
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!