You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

Found among branches of Acropora corals; a coral-commensal species (Ref. 72446). Solitary or in pairs, also found in reef crests and lagoons to 15 m (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Gobiodon histrio is distributed from the Red Sea to the Samoa Islands, north to the Ryukyu Islands, and south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea to Samoa, north to southern Japan, south to the Great Barrier Reef (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 10; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 35 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

3.5 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by mainly green body color with red to violet stripes or forming broken lines or row of spots on side; 4-5 reddish bars on head; absence of scales; complete pelvic fin frenum and basal membrane; depth of body at level of pelvic fins 2.2-2.7 in SL (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Gobiodon histro is a demersal species that is found among the branches of Acropora corals, especially Acropora nasuta colonies (Munday et al. 1997, Munday 2002, Hobbs and Munday 2004). This species relies on Acropora nasuta for shelter, food and a site for reproduction (Patton 1994, Nakashima et al. 1996). Gobiodon histro competes with other Gobiodon species for access to colonies of Acropora nasuta (Munday et al. 2001). There are rarely more than two Gobiodon histrio individuals present per coral colony. The species conducts both protogynous and protandrous sex changes (i.e., can change sex in both directions) (Munday and Molony 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine, usually 2 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 1.25 - 10.7
  Temperature range (°C): 25.819 - 28.885
  Nitrate (umol/L): 0.055 - 0.923
  Salinity (PPS): 32.200 - 35.347
  Oxygen (ml/l): 4.427 - 4.685
  Phosphate (umol/l): 0.122 - 0.339
  Silicate (umol/l): 0.983 - 4.465

Graphical representation

Depth range (m): 1.25 - 10.7

Temperature range (°C): 25.819 - 28.885

Nitrate (umol/L): 0.055 - 0.923

Salinity (PPS): 32.200 - 35.347

Oxygen (ml/l): 4.427 - 4.685

Phosphate (umol/l): 0.122 - 0.339

Silicate (umol/l): 0.983 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon histrio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAGTCTTTGGTGCCTGAGCCGGGATAGTAGGAACCGCCCTAAGCCTACTTATTCGGGCCGAGCTTAGTCAACCTGGGGCCCTACTTGGGGACGACCAGGTTTATAACGTGATCGTTACTGCCCACGCATTTGTAATGATTTTCTTTATAGTAATGCCAATCATGATCGGGGGCTTTGGGAATTGACTAATTCCCTTAATGATCGGCGCCCCCGACATGGCCTTCCCTCGAATGAACAACATAAGCTTCTGGCTTCTTCCTCCTTCTTTCCTTCTGCTCCTAGCATCCTCAGGAGTTGAGGCGGGGGCAGGAACAGGGTGAACGGTTTATCCCCCATTAGCCGGCAACCTAGCACACGCTGGAGCATCCGTTGATTTGACTATCTTTTCTCTTCATCTTGCAGGAATCTCTTCTATCCTAGGGGCAATCAACTTCATTACCACTATCCTTAACATGAAGCCTCCTGCCATCTCTCAGTATCAGACACCCCTCTTCGTCTGAGCTGTCCTGATCACAGCCGTCCTACTGCTCCTTTCTCTCCCAGTCCTTGCTGCCGGAATTACAATACTTCTTACGGACCGAAACCTCAACACAACCTTTTTTGACCCTGCGGGCGGAGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon histrio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Acero, A., Fricke, R., Larson, H.K., Murdy, E. & Van Tassell, J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Gobiodon histrio has been assessed as Least Concern. This species is reported as common in parts of its range, and although harvested for the aquarium trade, this is unlikely to be a threat throughout its broad distribution. It is likely that the species is experiencing population declines due to habitat degradation, however currently this is a localised threat only and is not thought to be significantly impacting the global population size. Monitoring of the harvest levels, extent of harvest and habitat status of this species is needed to ensure these threats do not increase in the future.

Around 44% of Acropora species assessed for the IUCN Red List are listed as threatened or Near Threatened (IUCN 2008); Acropora nasuta is listed as Near Threatened however it is also noted that the species is widespread and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation. Since Gobiodon histrio relies on Acropora species, the future of these corals is important for this species. Although regarded as Least Concern at present, a reassessment in five or 10 years is advisable to determine the status of its habitat and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Gobiodon histrio is reported as common in Kimbe Bay (Munday 2000), however its abundance is closely correlated to the abundance of the coral Acropora nasuta (Munday et al. 1997).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Gobiodon histrio is commercially harvested for the aquarium trade, however the harvest levels are not known. This species is also likely to be suffering localised population declines due to habitat degradation. Coral reefs in the Red Sea have been severely degraded by coral bleaching, Crown of Thorns starfish outbreaks, water pollution (sedimentation) and human population pressures. However these threats are not consistent over the entire range of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Gobiodon histrio, however its distribution may coincide with numerous marine protected areas (MPAs) including the Great Barrier Reef Marine Park (GBRMP). Monitoring of the harvest levels, extent of harvest and habitat status of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gobiodon histrio

Gobiodon histrio, the Broad-barred goby, is a species of goby native to the Indian Ocean from the Red sea to the western Pacific Ocean to southern Japan, Samoa and the Great Barrier Reef. This species is a reef dweller, being found at depths of from 2 to 15 metres (6.6 to 49 ft). It can reach a length of 3.5 centimetres (1.4 in) TL. This species can also be found in the aquarium trade.[3]

This fish produces a toxin that deters predators. When disturbed, it releases compounds that inhibit the locomotion of other fish. At high enough concentrations, the toxin causes the predator to lose equilibrium and tip over.[4][5] It takes part in a mutualistic relationship with a species of coral, Acropora nasuta. When the coral is damaged by toxic Chlorodesmis algae, it produces a compound that attracts the fish. The fish eat the alga and this enhances their toxicity.[5]

G. histrio can change sex in either direction. When a pair of gobies of the same sex colonize a new coral patch, one of them changes to the opposite sex.[6][7]

References[edit source | edit]

  1. ^ Acero, A., Fricke, R., Larson, H.K., Murdy, E. & Van Tassell, J. 2010. Gobiodon histrio. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 25 August 2013.
  2. ^ Herler, J., Bogorodsky, S.V. & Suzuki, T. (2013): Four new species of coral gobies (Teleostei: Gobiidae: Gobiodon), with comments on their relationships within the genus. Zootaxa, 3709 (4): 301–329.
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Gobiodon histrio" in FishBase. June 2013 version.
  4. ^ Schubert, M.; Munday, P. L.; Caley, M. J.; Jones, G. P.; Llewellyn, L. E. (2003). Environmental Biology of Fishes 67 (4): 359. doi:10.1023/A:1025826829548.  edit
  5. ^ a b Dixson, D. L.; Hay, M. E. (2012). "Corals Chemically Cue Mutualistic Fishes to Remove Competing Seaweeds". Science 338 (6108): 804–807. doi:10.1126/science.1225748. PMID 23139333.  edit
  6. ^ Kroon, F. J.; Munday, P. L.; Pankhurst, N. W. (2003). "Steroid hormone levels and bi-directional sex change in Gobiodon histrio". Journal of Fish Biology 62: 153. doi:10.1046/j.1095-8649.2003.00017.x.  edit
  7. ^ Munday, P. (2002). "Bi-directional sex change: Testing the growth-rate advantage model". Behavioral Ecology and Sociobiology 52 (3): 247–254. doi:10.1007/s00265-002-0517-8.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!