You are viewing this Taxon as classified by:

Overview

Brief Summary

The Broad-barred Goby (Gobiodon histrio) is found in the Indo-West Pacific from the Red Sea to Samoa, north to southern Japan and south to the Great Barrier Reef off eastern Australia (Lieske and Myers 2001).

Gobiodon gobies are among the most habitat-specialized fishes on coral reefs, living among the branches of scleratinian corals (stony corals) and having specific associations with one or more species of coral, mostly from the genus Acropora. In a study in Papua New Guinea, the Broad-barred Goby was observed in corals belonging to a number of different Acropora species, but only A. nasuta was actively favored, i.e., used more frequently than expected based simply on its availability. (Munday 2000)  Different Acropora species were favored in the Gulf of Aqaba in the northern Red Sea (Dirnwöber and Herler 2007). On the Great Barrier Reef in Australia, where there are two color morphs of A. nasuta, Broad-barred Gobies usually inhabit colonies of the "blue-tip" morph and only rarely the "brown-tip" morph, although these color forms seem truly to be members of the same species (Mackenzie et al. 2004).

In their investigations in the Gulf of Aqaba, Wall and Herler (2008) found that each coral colony is typically occupied by a single breeding pair of Broad-barred Gobies. Only very rarely do juveniles share colonies with adult fishes. Gobies may switch corals in their search for optimal breeding habitat or mates. Breeding pairs exhibit higher home-coral fidelity. (Wall and Herler 2008 and references therein)

Broad-barred Gobies rarely leave the shelter of their host coral colony. However, oxygen levels in this environment can drop very low and at very low tide the entire coral can be exposed to the air. The high tolerance of Broad-barred Gobies for hypoxia and their limited ability to obtain oxygen even when exposed to the air may be essential adaptations for their lifestyle. (Nilsson et al. 2004)

Broad-barred Gobies are among the substantial fraction of coral reef fishes that can change sex in the course of their lives. Although most fish species in which individuals change their sex in the course of their lifetime change in just one direction, i.e., either from female to male (protogyny) or male to female (protandry), in some species, including the Broad-barred Goby, sex can change in either direction (Kroon et al. 2003).

Dixson and Hay (2012) documented a remarkable mutualistic relationship between a coral, Acropora nasuta, and the Broad-barred Goby. These gobies are recruited by the coral to keep it free of the green filamentous macroalga Turtleweed (Chlorodesmis fastigiata), which can harm the coral. Within minutes of Turtleweed (or even a chemical extract from the Turtleweed) contacting the coral, the coral releases an odor that recruits gobies to snack on the Turtleweed and dramatically reduce coral damage that would otherwise occur. Broad-barred Gobies normally produces toxic skin secretions that repel predators and contact with the Turtleweed appears to increase their toxicity.

 

  • Dirnwöber, M. and J. Herler. 2007. Microhabitat specialisation and ecological consequences for coral gobies of the genus Gobiodon in the Gulf of Aqaba, northern Red Sea. Marine Ecology Progress Series 342: 265-275.
  • Dixson, D.L. and M.E. Hay. 2012. Corals chemically cue mutualistic fishes to remove competing seaweeds. Science 338: 804-807.
  • Lieske, E. and R. Myers, 1994. Coral Reef Fishes: Indo-Pacific & Caribbean, revised edition. Princeton University Press, Princeton.
  • Mackenzie, J.B., P.L. Munday, B.L. Willis, D.J. Miller, and M.J.H. van Oppen. 2004. Unexpected patterns of genetic structuring among locations but not colour morphs in Acropora nasuta (Cnidaria; Scleractinia). Molecular Ecology 13: 9-20.
  • Munday, P.L. 2000. Interactions between habitat use and patterns of abundance in coral-dwelling fishes of the genus Gobiodon. Environmental Biology of Fishes 58: 355-369.
  • Nilsson, G.E., J.-P. Hobbs, P.L. Munday, and S. Östlund-Nilsson. 2004. Coward or braveheart: extreme habitat fidelity through hypoxia tolerance in a coral-dwelling goby. The Journal of Experimental Biology 207: 33-39.
  • Wall, M. and J. Herler. 2009. Postsettlement movement patterns and homing in a coral-associated fish. Behavioral Ecology 20(1): 87-95.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found among branches of Acropora corals; a coral-commensal species (Ref. 72446).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Gobiodon histrio is distributed from the Red Sea to the Samoa Islands, north to the Ryukyu Islands, and south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Red Sea to Samoa, north to southern Japan, south to the Great Barrier Reef (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 35 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

3.5 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Gobiodon histro is a demersal species that is found among the branches of Acropora corals, especially Acropora nasuta colonies (Munday et al. 1997, Munday 2002, Hobbs and Munday 2004). This species relies on Acropora nasuta for shelter, food and a site for reproduction (Patton 1994, Nakashima et al. 1996). Gobiodon histro competes with other Gobiodon species for access to colonies of Acropora nasuta (Munday et al. 2001). There are rarely more than two Gobiodon histrio individuals present per coral colony. The species conducts both protogynous and protandrous sex changes (i.e., can change sex in both directions) (Munday and Molony 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine, usually 2 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 1.25 - 10.7
  Temperature range (°C): 25.819 - 28.885
  Nitrate (umol/L): 0.055 - 0.923
  Salinity (PPS): 32.200 - 35.347
  Oxygen (ml/l): 4.427 - 4.685
  Phosphate (umol/l): 0.122 - 0.339
  Silicate (umol/l): 0.983 - 4.465

Graphical representation

Depth range (m): 1.25 - 10.7

Temperature range (°C): 25.819 - 28.885

Nitrate (umol/L): 0.055 - 0.923

Salinity (PPS): 32.200 - 35.347

Oxygen (ml/l): 4.427 - 4.685

Phosphate (umol/l): 0.122 - 0.339

Silicate (umol/l): 0.983 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Dixson and Hay (2012) documented a remarkable mutualistic relationship between the Broad-barred Goby and the coral Acropora nasuta. Broad-barred Gobies are recruited by the coral to keep it free of the green filamentous macroalga Turtleweed (Chlorodesmis fastigiata), which can harm the coral. Within minutes of Turtleweed (or even a chemical extract from the Turtleweed) contacting the coral, the coral releases an odor that recruits gobies to snack on the Turtleweed and dramatically reduce coral damage that would otherwise occur. Broad-barred Gobies normally produces toxic skin secretions that repel predators and contact with the Turtleweed appears to increase their toxicity.

 

  • Dixson, D.L. and M.E. Hay. 2012. Corals chemically cue mutualistic fishes to remove competing seaweeds. Science 338: 804-807.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon histrio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAGTCTTTGGTGCCTGAGCCGGGATAGTAGGAACCGCCCTAAGCCTACTTATTCGGGCCGAGCTTAGTCAACCTGGGGCCCTACTTGGGGACGACCAGGTTTATAACGTGATCGTTACTGCCCACGCATTTGTAATGATTTTCTTTATAGTAATGCCAATCATGATCGGGGGCTTTGGGAATTGACTAATTCCCTTAATGATCGGCGCCCCCGACATGGCCTTCCCTCGAATGAACAACATAAGCTTCTGGCTTCTTCCTCCTTCTTTCCTTCTGCTCCTAGCATCCTCAGGAGTTGAGGCGGGGGCAGGAACAGGGTGAACGGTTTATCCCCCATTAGCCGGCAACCTAGCACACGCTGGAGCATCCGTTGATTTGACTATCTTTTCTCTTCATCTTGCAGGAATCTCTTCTATCCTAGGGGCAATCAACTTCATTACCACTATCCTTAACATGAAGCCTCCTGCCATCTCTCAGTATCAGACACCCCTCTTCGTCTGAGCTGTCCTGATCACAGCCGTCCTACTGCTCCTTTCTCTCCCAGTCCTTGCTGCCGGAATTACAATACTTCTTACGGACCGAAACCTCAACACAACCTTTTTTGACCCTGCGGGCGGAGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon histrio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Acero, A., Fricke, R., Larson, H.K., Murdy, E. & Van Tassell, J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Gobiodon histrio has been assessed as Least Concern. This species is reported as common in parts of its range, and although harvested for the aquarium trade, this is unlikely to be a threat throughout its broad distribution. It is likely that the species is experiencing population declines due to habitat degradation, however currently this is a localised threat only and is not thought to be significantly impacting the global population size. Monitoring of the harvest levels, extent of harvest and habitat status of this species is needed to ensure these threats do not increase in the future.

Around 44% of Acropora species assessed for the IUCN Red List are listed as threatened or Near Threatened (IUCN 2008); Acropora nasuta is listed as Near Threatened however it is also noted that the species is widespread and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation. Since Gobiodon histrio relies on Acropora species, the future of these corals is important for this species. Although regarded as Least Concern at present, a reassessment in five or 10 years is advisable to determine the status of its habitat and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Gobiodon histrio is reported as common in Kimbe Bay (Munday 2000), however its abundance is closely correlated to the abundance of the coral Acropora nasuta (Munday et al. 1997).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Gobiodon histrio is commercially harvested for the aquarium trade, however the harvest levels are not known. This species is also likely to be suffering localised population declines due to habitat degradation. Coral reefs in the Red Sea have been severely degraded by coral bleaching, Crown of Thorns starfish outbreaks, water pollution (sedimentation) and human population pressures. However these threats are not consistent over the entire range of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Gobiodon histrio, however its distribution may coincide with numerous marine protected areas (MPAs) including the Great Barrier Reef Marine Park (GBRMP). Monitoring of the harvest levels, extent of harvest and habitat status of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gobiodon histrio

Gobiodon histrio, the Broad-barred goby, is a species of goby native to the Indian Ocean from the Red sea to the western Pacific Ocean to southern Japan, Samoa and the Great Barrier Reef. This species is a reef dweller, being found at depths of from 2 to 15 metres (6.6 to 49 ft). It can reach a length of 3.5 centimetres (1.4 in) TL. This species can also be found in the aquarium trade.[3]

This fish produces a toxin that deters predators. When disturbed, it releases compounds that inhibit the locomotion of other fish. At high enough concentrations, the toxin causes the predator to lose equilibrium and tip over.[4][5] It takes part in a mutualistic relationship with a species of coral, Acropora nasuta. When the coral is damaged by toxic Chlorodesmis algae, it produces a compound that attracts the fish. The fish eat the alga and this enhances their toxicity.[5]

G. histrio can change sex in either direction. When a pair of gobies of the same sex colonize a new coral patch, one of them changes to the opposite sex.[6][7]

References[edit source | edit]

  1. ^ Acero, A., Fricke, R., Larson, H.K., Murdy, E. & Van Tassell, J. 2010. Gobiodon histrio. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 25 August 2013.
  2. ^ Herler, J., Bogorodsky, S.V. & Suzuki, T. (2013): Four new species of coral gobies (Teleostei: Gobiidae: Gobiodon), with comments on their relationships within the genus. Zootaxa, 3709 (4): 301–329.
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Gobiodon histrio" in FishBase. June 2013 version.
  4. ^ Schubert, M.; Munday, P. L.; Caley, M. J.; Jones, G. P.; Llewellyn, L. E. (2003). Environmental Biology of Fishes 67 (4): 359. doi:10.1023/A:1025826829548.  edit
  5. ^ a b Dixson, D. L.; Hay, M. E. (2012). "Corals Chemically Cue Mutualistic Fishes to Remove Competing Seaweeds". Science 338 (6108): 804–807. doi:10.1126/science.1225748. PMID 23139333.  edit
  6. ^ Kroon, F. J.; Munday, P. L.; Pankhurst, N. W. (2003). "Steroid hormone levels and bi-directional sex change in Gobiodon histrio". Journal of Fish Biology 62: 153. doi:10.1046/j.1095-8649.2003.00017.x.  edit
  7. ^ Munday, P. (2002). "Bi-directional sex change: Testing the growth-rate advantage model". Behavioral Ecology and Sociobiology 52 (3): 247–254. doi:10.1007/s00265-002-0517-8.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!