Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in patches or expanses of coarse carbonate sand on outer lagoon and seaward reefs. Inhabits coastal to outer reef sand slopes to 25 meters depth (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Philippines to Tonga, north to the Ryukyu Islands, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 90 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 40 m (Ref. 27115), usually 10 - 40 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0.9 - 34
  Temperature range (°C): 26.645 - 29.186
  Nitrate (umol/L): 0.025 - 0.834
  Salinity (PPS): 33.797 - 35.216
  Oxygen (ml/l): 4.430 - 4.744
  Phosphate (umol/l): 0.079 - 0.284
  Silicate (umol/l): 0.810 - 4.892

Graphical representation

Depth range (m): 0.9 - 34

Temperature range (°C): 26.645 - 29.186

Nitrate (umol/L): 0.025 - 0.834

Salinity (PPS): 33.797 - 35.216

Oxygen (ml/l): 4.430 - 4.744

Phosphate (umol/l): 0.079 - 0.284

Silicate (umol/l): 0.810 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in patches or expanses of coarse carbonate sand on outer lagoon and seaward reefs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblyeleotris guttata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTCGTGTTCGGTGCCTGAGCCGGAATAGTGGGCACAGCACTTAGCCTGCTAATCCGGGCCGAACTCTCCCAACCCGGAGCCCTACTGGGAGACGACCAGATCTACAACGTTATTGTAACCGCCCACGCGTTTGTAATAATTTTCTTTATAGTAATACCAATCATAATCGGAGGATTCGGAAATTGACTAATTCCGCTCATGATCGGGGCCCCCGACATGGCCTTCCCTCGAATAAACAACATGAGTTTCTGACTCTTGCCCCCTTCTTTCCTCCTACTTCTCGCCTCCTCTGGGGTTGAAGCCGGAGCTGGTACAGGCTGAACTGTCTACCCCCCACTTGCAGGCAACCTAGCACATGCAGGAGCTTCCGTTGACCTAACCATTTTCTCCCTCCACTTAGCGGGTATCTCCTCAATTCTTGGGGCAATCAACTTCATCACAACAATCCTAAACATGAAACCCCCAGCCATCTCACAATACCAAACACCCCTGTTTGTTTGAGCAGTACTAATTACAGCTGTCCTTCTCCTCCTTTCCCTCCCAGTTCTTGCCGCTGGCATCACAATGCTTCTAACAGACCGAAACCTCAATACAACTTTCTTCGACCCCGCAGGCGGAGGAGACCCTATCCTCTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblyeleotris guttata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted prawn goby

Amblyeleotris guttata, theSpotted prawn-goby is a species of goby native to reefs of the Western Pacific Ocean, that includ the Philippines to Tonga, north to the Ryukyu Islands, south to Australia.[1]

This species can reach a length of 11 centimetres (4.3 in) SL.[2] It can also be found in the aquarium trade.[3]

References[edit]

  1. ^ http://www.fishbase.org/summary/6671
  2. ^ http://eol.org/pages/213527/details#size
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Amblyeleotris guttata" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!