Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Benthic in crevices (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: anti-tropical in distribution. Reported from Seychelles (Ref. 1623) but Randall and van Egmond 1994 (Ref. 10685) believe otherwise. Eastern Pacific: Costa Rica and Easter Island (Ref. 9710) and Chile (Ref. 9068).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, Reunion, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific, antiequatorial: Transkei (South Africa), Madagascar and Mascarenes east to Cocos Island, north to Ryukyu Islands, Ogasawara Islands, Minami Tori Shima, and Hawaiian Islands, Marquesas Islands and Easter Island, south to Shark Bay (Western Au
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 120 - 123
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark purplish brown with small yellow spots which is sparse on the tail (Ref. 3257). This species is similar to Gymnothorax meleagris in having biserial maxillary teeth, with inner and outer series about equal in length; intermaxillary teeth arranged in a peripheral series, a median series, and an intermediate series on each side between the median and peripheral series. (Ref. 74922).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 74 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0.8 - 40
  Temperature range (°C): 22.368 - 27.306
  Nitrate (umol/L): 0.047 - 0.537
  Salinity (PPS): 34.132 - 35.560
  Oxygen (ml/l): 4.558 - 5.079
  Phosphate (umol/l): 0.092 - 0.284
  Silicate (umol/l): 0.910 - 4.892

Graphical representation

Depth range (m): 0.8 - 40

Temperature range (°C): 22.368 - 27.306

Nitrate (umol/L): 0.047 - 0.537

Salinity (PPS): 34.132 - 35.560

Oxygen (ml/l): 4.558 - 5.079

Phosphate (umol/l): 0.092 - 0.284

Silicate (umol/l): 0.910 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on fish and benthic crustaceans (Ref. 3921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax eurostus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCTGGGATGGTCGGCACTGCCCTAAGCCTGCTGATCCGAGCCGAGCTGAGCCAACCCGGAGCCCTCCTGGGTGACGACCAAATTTACAATGTCATTGTAACAGCCCATGCGTTCGTTATGATTTTCTTTATAGTAATGCCTGTAATAATTGGAGGCTTCGGAAATTGACTAATTCCGTTAATAATTGGTGCCCCCGACATGGCATTCCCACGAATAAATAATATAAGCTTCTGGCTACTCCCCCCCTCTTTCTTACTACTATTAGCTTCCTCCGGCGTTGAAGCCGGGGCAGGGACGGGATGGACTGTTTACCCCCCTCTTGCAGGAAACCTGGCCCATGCTGGCGCATCTGTAGACTTAACTATCTTTTCCCTTCATTTAGCAGGGGTTTCATCGATCCTAGGAGCAATCAATTTTATCACAACCATCATCAACATAAAACCCCCAGCCATCACACAGTACCAAACACCATTATTCGTCTGGGCGGTTTTAGTAACAGCAGTATTGCTACTACTCTCCCTGCCAGTGCTAGCAGCCGGCATTACGATGCTTTTAACCGATCGAAACCTTAACACAACATTCTTCGACCCGGCCGGAGGTGGTGACCCAATTTTATATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax eurostus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Abbott's moray eel

The Abbott's moray eel, Gymnothorax eurostus, is a moray eel of the family Muraenidae, found in the Indo-Pacific antitropical[1] in distribution. Reported from the Seychelles. Found in the eastern Pacific from Costa Rica and Easter Island, at depths down to 40 m. Its length is up to 60 cm.

The Abbott's moray eel is a shallow-water, inshore reef species, though not often seen.

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2006). "Gymnothorax eurostus" in FishBase. June 2006 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!