Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit channels, moats, lagoon and seaward reefs with strong surge (Ref. 48637). Benthopelagic (Ref. 58302). Typically occurring in small groups. Juveniles in shallow protected bays and harbours (Ref. 48637). Mainly diurnal, feed on coarse leafy brown algae like Sargassum. Pair-spawning has been observed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Naso unicornis is found from the Red Sea and East Africa to the Hawaiian Islands and Pitcairn Islands, northwards to southern Japan, southwards to New South Wales, Lore Howe Island, and Norfolk Island. It is also reported from Western Australia. It was recently recorded from Easter Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands, Marquesas Islands and Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to New Caledonia, Lord Howe Island and R
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (Ref. 3145) to the Hawaiian, Marquesas and Tuamoto islands, north to southern Japan, south to Lord Howe and Rapa islands. Presence in Somalia to be confirmed (Ref. 30573).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 27 - 30; Analspines: 2; Analsoft rays: 27 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm FL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits channels, moats, and seaward reefs with strong surge. A wary species, typically occurring in small groups, in very shallow surgy water. Mainly diurnal, it feeds on coarse leafy brown algae like @Sargassum@. Pair-spawning has been observed. Rarely poisonous around Tahiti but few cases of poisoning have been reported from the Leeward Is. and the Marquesas islands (Ref. 4795).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is characterized by the following: body depth 1.8 (in subadults) - 2.6 (adults) in SL; presence of a tapering body horn in adults projecting anteriorly at level of eye but not extending in front of mouth (horn first as a bump on forehead at a length of about 12 cm); dorsal profile from snout to horn straight, angle of about 45°; 2 peduncular plates with well-developed forward-curving knife-like spines; emarginate caudal fin when young, truncate with filamentous lobes in adult; olivaceous with blue peduncular plates and spines; dorsal and anal fins yellowish with narrow blue stripes (Ref. 27362).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Naso unicornis is found in inshore coral reefs but will enter shallow water (Randall 2001a). It feeds on macroscopic algae, mainly larger brown algae (Turbinaria and Dictyota) (Choat et al. 2002, 2004). It undergoes ontogenetic habitat shifts from shallow, sheltered areas of the reef to deeper, more exposed habitats (Meyer and Holland 2005), juveniles move from shallow reef flats to the reef crest at approximately 12 cm (J. McIlwain pers. obv.). It typically occurs in small groups, migrates around the outer reef edge, and spawns around both new and full moons (Johannes 1981, Arai and Sato 2007).

Home range estimates of N. unicornis from a study on Guam ranged from 51 m2 to 100,045 m2 (mean = 30,227 m2) almost ten times that for the same species in Hawaii (mean = 3,172 m2) (Meyer et al. 2000, Marshall unpub thesis). These differences may reflect differences in methods with the former employing a remote array deployed over five months and the latter a hand-held hydrophone used to track individual fish for a maximum of 21 days. There was a strong ontogenetic shift in both home range size and habitat preference at both locations. On Guam, large individuals (26 cm) use not only the shallow reef flats but range over deeper, more exposed habitat on the reef slope

Reproduction

The sexes are separate and there is evidence of sexual dimorphism in the caudal knives which are relatively larger in males (J.H. Choat pers. comm. 2010). Size at first reproduction (L50) for females collected from the fishery in Guam (2008-2009) was 328 mm (J. McIlwain unpub.data). In Hawaii the L50 for reproductive females collected only in June was 378 mm (Eble et al. unpub report). The smallest females with vitellogenic or hydrated oocytes were 286 mm and 342 mm respectively. The L50 for males from Hawaii was 286 mm, and the smallest male with sperm present was 266 mm. For the Hawaiian fishery, two thirds of females enter the fishery before maturation (Eble et al. 2009). In Guam, mature or spent females were only recorded from August to October during 2008. This species exhibits high recruitment rates (J. McIlwain unpub. data).

In Hawaii, mean age from a sample of 197 fish was 12.8 yrs (range of 1-58 yrs). They found no evidence of sexual dimorphism in size or differences in growth among locations. Males reached age at first maturity at 4.5 yrs, 7.5 years for females at 37.8 cm (TL) (J. Eble unpub. report). In the Great Barrier Reef females reach first maturity at four years 30-35 cm (TL) (J.H. Choat pers comm. 2010).

It was observed to form spawning aggregations on the Great Barrier Reef (Johannes 1981, Squire and Samoilys unpub.). The large pelagic larvae persist in the pelagic environment for approximately 90 days (B.Victor pers comm. in Horne et al. 2008).

Age

The number of sagital increments in a study done by Choat and Axe (1996) suggest that members of the genus Naso attain the same maximum ages as the other Acanthurids, in excess of 20 years for this species. Maximum age was 30 years in the Great Barrier Reef (Choat and Robertson 2002a), 58 years in Hawaii (Eble 2009).

Movement

A study by Meyer and Holland (2005) revealed the first nocturnal movements in surgeonfishes. Naso unicornis moved up to 170 m on nights where moonlight was completely absent. The study also showed that this species was site-attached to home ranges situated within the boundaries of the study area and their movements were aligned with topographical features.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 80m.
From 1 to 80 meters.

Habitat: reef-associated. Bluespine unicorn.  (Forsskal, 1775) Attains 70 cm. Indo-Pacific, south to Natal in South Africa. A species of coral reefs and rocky shores; enters surprisingly shallow water for such a large fish; feeds on benthic algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 80 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 0.305 - 50000
  Temperature range (°C): 6.367 - 29.336
  Nitrate (umol/L): 0.043 - 36.879
  Salinity (PPS): 34.134 - 35.368
  Oxygen (ml/l): 1.616 - 4.753
  Phosphate (umol/l): 0.092 - 2.717
  Silicate (umol/l): 1.096 - 87.145

Graphical representation

Depth range (m): 0.305 - 50000

Temperature range (°C): 6.367 - 29.336

Nitrate (umol/L): 0.043 - 36.879

Salinity (PPS): 34.134 - 35.368

Oxygen (ml/l): 1.616 - 4.753

Phosphate (umol/l): 0.092 - 2.717

Silicate (umol/l): 1.096 - 87.145
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits channels, moats, lagoon and seaward reefs with strong surge. Typically occurring in small groups. Juveniles in shallow protected bays and harbours (Ref. 48637). Mainly diurnal. Feeds on coarse leafy brown algae like Sargassum. Large adults sometimes solitary at edge of reef (Ref. 3921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Hexangium Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawn in pairs (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Naso unicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGGACAGCATTAAGCCTTCTTATTCGAGCAGAACTGAGCCAACCAGGCGCCCTCCTCGGAGATGACCAAATCTATAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGAAACTGACTAATTCCCCTAATGATCGGGGCCCCAGACATGGCATTTCCCCGAATAAACAACATGAGCTTCTGATTACTCCCTCCCTCTTTCCTTCTCCTTCTTGCATCATCTGGGGTTGAAGCTGGGGCCGGAACCGGATGAACAGTCTACCCCCCTCTAGCGGGCAACCTGGCACATGCAGGAGCTTCCGTTGATCTGACTATTTTCTCTCTTCATCTGGCAGGAATTTCCTCAATTCTAGGGGCGATTAATTTCATCACAACTATCATTAACATGAAACCTCCTGCTATTTCTCAATACCAGACTCCCCTATTCGTCTGAGCTGTGTTAATCACGGCAGTGCTACTACTTCTTTCTCTTCCGGTTCTTGCTGCTGGCATTACAATACTTCTCACCGACCGAAACCTTAATACAACCTTCTTTGACCCTGCAGGCGGAGGGGATCCAATTCTTTACCAGCACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Naso unicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
McIlwain, J., Choat, J.H., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Naso unicornis is widespread in the Indo-Pacific. It is common and can achieve high abundances in parts of its range. It is a targeted fish species in most of its distribution. There have been signs of catch declines - however, with no corresponding effort data population declines cannot be easily quantified. There is no clear trend of population declines. It is found in a number of well-managed protected areas and has shown positive responses to protection. It is therefore listed as Least Concern. We recommend continued monitoring of the harvest levels and population status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

FAO capture production for Naso unicornis from Saudi Arabia recorded 126 tonnes in 2000 to 191 tonnes in 2001, catch decreased from 2002-2004 with 133, 145 and 113 tonnes respectively; it has increased since then with 195 tonnes recorded in 2007. There are no capture production records prior to 2000. Density of N. unicornis was 3-10 times greater after marine reserves around five islands in New Caledonia were protected from fishing for 4 yrs (Wantiez et al. 1997). In the central Philippines, there were two orders of magnitude difference in mean biomass between fished areas and marine reserves (0.5 to 11 years protection) (Stockwell et al. 2009).

In Saipan, this species was the most abundant fish in the surveys with landings accounting for 14% of the total fish landings, and 50% of the acanthurids landings (P. Houk unpublished data). Census data from seven sites around Saipan using timed visual surveys on SCUBA revealed N. unicornis was extremely rare at 0.05% of the total acanthurid abundance. A similar result was found on Guam, where this species made up 17% of the acanthurid fishery but was rarely recorded during visual surveys. In these and other locations where spearfishing is the primary fishing method, daytime visual surveys using fixed length transects might be inappropriate.

In the Federal States of Micronesia, particularly Yap, N. unicornis accounts for approximately 12% of the total catch landed from the sheltered coastal reefs and lagoons at two sites Yyin and Riiken (Kronen et al. 2006). On Pohnpei, this species is the second most abundant acanthurid in the fishery (26% of all acanthurids) (Rhodes et al. 2008). Analysis of longterm fishery data (1984-2007) from Guam reveal no decline in mean individual weight for this species (Division of Aquatic and Wildlife Resources unpub. data). An average of 7,700 kg/year is landed in Hawaii (Division of Aquatic Resources unpub. data). This species is collected as an aquarium fish in West Hawaii. The total number of individuals caught from FY 2005-2009 was 24 with a total value of $68 (Walsh et al. 2010).

This species was recorded as occasional in terms of relative abundance in Palawan Province, Philippines and the northern Bismarck Sea, Papua New Guinea (Werner and Allen 2000, Palawan Council for Sustainable Develeopment, Allen 2009). It is moderately common in Milne Bay Province, Papua New Guinea and in Raja Ampat, Indonesia (Allen 2003, 2003b). In Moorea, French Polynesia, SPOT satellite images allowed estimation of the surface area of fringing reef (1,076 ha), barrier reef (3,788 ha) and outer slop (493 ha). A total of 21,346 individuals were recorded in this area in fish visual surveys conducted from 1990-1993 (Lecchini et al. 2006).

In the Nabq Managed Resource Protected Area, South Sinai, Egyptian Red Sea, mean abundance of this species was higher in the fished areas than in the no-take zones across 3 and 10 m depths. This can be attributed to a result of reduced predation or competition (Ashworth and Ormond 2005). In a stock assessment conducted at the northern province of New Caledonia by Letourneur et al. (2000), density and biomass was higher in the north zone and on barrier reefs (17.5 g m-2 and 129 ×10-4 individuals m-2) compared to other areas surveyed and other reef types.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Naso unicornis is a targeted food fish. There have been significant reductions in biomass in parts of its range.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range. In Queensland, Australia, there is a recreational catch limit of five per species and a minimum size limit of 25 cm (Department of Primary Industries accessed 8 April 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bluespine unicornfish

A pair of bluespine unicornfish (Naso unicornis) found in shallow water coral reef area of Green Island, a coral reef ecosystem reserve in Taiwan

The bluespine unicornfish or short-nose unicornfish (Naso unicornis) is a tang from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 70 cm in length. It is called kala in Hawaiian, and dawa in New Caledonia.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!