Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: unicornfish (English), pez-unicornio (Espanol)
 
Naso hexacanthus (Bleeker, 1855)


Sleek unicornfish


Body elongate, oval; upper and lower body profiles symmetrically convex; forehead without horn; mouth small, protrusible, low on head; teeth small, conical, tips slightly depressed & either smooth or with multiple small points; dorsal fin VI, 27-29; anal II, 27-30; pectoral 17-18 rays; pelvics I, 3; 2 pairs of cutting keels on plates on narrow tail base; tail margin straight, without filaments, concave in juveniles;  scales very small, rough; lateral line complete.



Blue-grey to brown above, shading to yellowish brown ventrally; rear margin of operculum and preopercle often dark; tongue black; dorsal olive; tail blue grey, broad olive margin; anal and pelvics yellow-olive; pectoral blue grey, dark margin; courting males  can abruptly develop upper head and upper front of body blue, blue lines and spots on front flank.


Size: 75 cm.

        
        Habitat: reefs and rocky shores; juveniles on reef crests in sheltered habitats; adults in midwater around exposed reef fronts.

Depth: 0-150 m; juveniles usually 5-35 m; adults usually 10-40 m.

An Indo-Pacific species recorded as a vagrant at Clipperton and Cocos Islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits clear lagoon and seaward reef slopes (Ref. 9710, 48637). Benthopelagic (Ref. 58302). Forms shoals. Mainly diurnal, it feeds on zooplankton such as crab larvae, arrow worms, pelagic tunicates, and occasionally filamentous red algae. The species is never poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Naso hexacanthus is found from the Red Sea and East Africa including the Mascarene Islands to the Hawaiian, Marquesan and Ducie islands, northwards to southern Japan and southwards to Lord Howe Island. It is reported in the eastern Pacific from Clipperton Island (Robertson and Allen 1996) and Cocos Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (Ref. 9710), including the Mascarene Islands (Ref. 37792) to the Hawaiian, Marquesan and Ducie islands, north to southern Japan, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles and western Mascarenes east to Hawaiian Islands, Marquesas Islands and Ducie (Pitcairn Group), north to southern Japan and Ogasawara Islands, south to Lord Howe Island and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 150 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 27 - 29; Analspines: 2; Analsoft rays: 27 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 75.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 750 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

75.0 cm FL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits seaward dropoffs, but usually found below 18 m. Forms schools. Mainly diurnal, it feeds on zooplankton, crab larvae, arrow worms, pelagic tunicates, and occasionally filamentous red algae. The species is never poisonous (Ref. 4795).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Almost fusiform, body grayish to greenish brown, paler below. Two weak immovable bucklers on each side of caudal peduncle. Without horn; short groove in front of eye. Yellowish brown preopercular margin. Over 25 cm with black tongue. Skin granulated or velvety. Teeth small and slender, close-set and pointed. Caudal fin emarginate in young.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Naso hexacanthus is often seen in large aggregations. It feeds on the larger animals of the zooplankton such as crab larvae, arrow worms and pelagic tunicates (Randall 2001b). The diet of this species consists almost exclusively of large gelatinous plankton. Juveniles feed on macroscopic and turf algae and strongly associated with reef substrata. It is herbivorous up to age 2 years. Juveniles are more common in mid-shelf reefs (Choat et al. 2002).
The number of sagital increments in a study done by Choat and Axe (1996) suggest that members of the genus Naso attain the same maximum ages as the other Acanthurids, in excess of 40 years for this species. Maximum age 44 years (Choat and Robertson 2002a).

Reproduction

The sexes are separate among the acanthurids (Reeson, 1983). Males have characteristic mating colours when courting in open water. Caudal knives in males are enlarged (J.H. Choat pers. comm. 2010). This species was observed to form spawning aggregations on the Great Barrier Reef (Johannes 1981). Size at sexual maturity 450 mm (Choat and Robertson 2002a).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 6 - 150 m (Ref. 30573), usually 10 - 137 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 2 - 64
  Temperature range (°C): 22.496 - 28.899
  Nitrate (umol/L): 0.019 - 1.642
  Salinity (PPS): 34.165 - 35.552
  Oxygen (ml/l): 4.393 - 5.079
  Phosphate (umol/l): 0.100 - 0.268
  Silicate (umol/l): 1.089 - 4.786

Graphical representation

Depth range (m): 2 - 64

Temperature range (°C): 22.496 - 28.899

Nitrate (umol/L): 0.019 - 1.642

Salinity (PPS): 34.165 - 35.552

Oxygen (ml/l): 4.393 - 5.079

Phosphate (umol/l): 0.100 - 0.268

Silicate (umol/l): 1.089 - 4.786
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 150m.
From 6 to 150 meters.

Habitat: reef-associated. Blacktongue unicorn.  (Bleeker, 1855) Attains 75 cm. Often seen in shoals in mid-water near reefs. Appears to feed on zooplankton, at least as adults. Sleeps on reefs at night. Indo-Pacific south to Bazaruto in Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits clear lagoon and seaward reef slopes (Ref. 9710, 48637). Forms shoals. Mainly diurnal, it feeds on zooplankton such as crab larvae, arrow worms, pelagic tunicates, and occasionally filamentous red algae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Planktivore, Omnivore

Diet: benthic microalgae, zooplankton, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Prosogonotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lecithocladium Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hurleytrematoides Infestation 7. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawn in pairs (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Naso hexacanthus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Naso hexacanthus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTAAGTCTACTCATTCGGGCAGAACTAAGCCAACCAGGCGCCCTCCTCGGAGATGACCAAATCTATAATGTAATTGTTACGGCGCATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGAAACTGACTAATTCCACTAATGATCGGGGCCCCAGATATGGCATTCCCCCGAATAAACAACATGAGCTTTTGACTGCTCCCTCCCTCTTTCCTCCTCCTCCTTGCATCATCTGGTGTAGAAGCCGGGGCTGGAACCGGATGAACAGTTTATCCCCCTTTAGCTGGTAATCTAGCACATGCAGGAGCTTCCGTTGATCTGACTATTTTCTCCCTTCATCTGGCAGGAATCTCCTCAATTCTAGGGGCCATTAACTTCATCACAACCATCATCAATATGAAACCTCCTGCTATTTCTCAGTACCAAACTCCCCTGTTTGTCTGAGCTGTACTAATCACGGCAGTTCTGTTACTTCTATCTCTTCCAGTCCTTGCTGCTGGTATTACAATGCTCCTTACCGACCGAAACCTTAACACAACCTTCTTCGACCCCGCAGGAGGAGGGGACCCAATTCTTTACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., McIlwain, J., Abesamis, R., Clements, K.D., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Naso hexacanthus is widespread in the Indo-Pacific region. It is common and locally abundant in parts of its range. It is a popular food fish and although common in fish markets and targeted in the Philippines, there is no evidence of population declines due to fishing. It is found in a number of well-policed marine protected areas in parts of its distribution. It has a wide depth range and is generally found in deeper waters. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Naso hexacanthus is not common in depths less than about 15 m, but abundant in deeper water, particularly near escarpments (Randall 2001b). It was recorded as occasional in terms of relative abundance in the northern Bismarck Sea, Papua New Guinea (Allen 2009), occasional but locally common to abundant in Milne Bay Province, Papua New Guinea (Allen 2003). It is moderately common at Raja Ampat, Indonesia (Allen 2003b). It is uncommon in the American Samoa National Park (National Park of Samoa Checklist of Fishes accessed 21 April 2010). It is common in drop-offs in Palau (R. Myers, pers comm. 2010). It is common and locally abundant in the Philippines (R. Abesamis and B. Stockwell pers. comm. 2010).

In the Apo Island, Philippines fishery beginning March and through August - it is abundant in catch when it is the season for small jellyfish, and spearfishers can catch N. hexacanthus using breathhold spearfishing at night during the new moon. Hook and line is used during the day. During the peak in jellyfish season (June-July) fishers can land up to 60 kg. (3 fishers). The one fisher average is of 10 fish (A. Candido pers. comm. 2010).

It is uncommon in Guam (J. McIlwain unpub. data). It is not recorded in the Pohnpei fishery in 2007 (Rhodes et al. 2008). In Hawaii an average of 1,400 kg/year is harvested. N. hexacanthus is the sixth most important Acanthurid species (Division of Aquatic Resources unpub. data). It is a commercial species in the Tuamotos and French Polynesia (de Loma et al. 2009).
In Kenya, landings during 1978-2001 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s, but the landings for the scarinae showed a rising trend in recent years (Kaunda-Arara et al. 2003).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Naso hexacanthus is a targeted food fish in parts of its range.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Naso hexacanthus

Naso hexacanthus is a tropical fish found in coral reefs in the Pacific and Indian Oceans.[1] It is commonly known as the sleek unicornfish, sleek unicorn, blacktongue unicorn, blacktounge unicornfish, Thorpe's unicornfish, or the Nohorn unicorn.[2] It is of value in commercial fisheries and as a gamefish, and is also seen in aquaria.[1]

References[edit]

  1. ^ a b Naso hexacanthus at www.fishbase.org.
  2. ^ Common names for Naso hexacanthus at www.fishbase.org.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!