Overview
Comprehensive Description
Biology
Found in deep coastal to outer reef drop-offs and steep slopes. Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile. Juveniles solitary among large rubble, usually in 2-30 m depth. Adults in loose aggregations in moderate depths, usually 40 m or more around patch reef (Ref. 48636).
-
Randall, J.E. 1992 A review of the labrid fishes of the genus Cirrhilabrus from Japan, Taiwan and the Mariana Islands, with descriptions of two new species. Micronesica 25(1):99-121. (Ref. 5278)
http://www.fishbase.org/references/FBRefSummary.php?id=5278&speccode=5106
Trusted
Distribution
Western Pacific: north to the Ryukyu Islands, through the Philippines, Palau, and Indonesia to Vanuatu, Fiji, and Tonga.
-
Randall, J.E. 1992 A review of the labrid fishes of the genus Cirrhilabrus from Japan, Taiwan and the Mariana Islands, with descriptions of two new species. Micronesica 25(1):99-121. (Ref. 5278)
http://www.fishbase.org/references/FBRefSummary.php?id=5278&speccode=5106
Trusted
Range Description
This species is known from the north of the Ryukyu Islands, Japan through the Philippines, Sabah (Malaysia), Palau, and Indonesia to Vanuatu, Fiji, and Tonga. It has also been reported from Cocos-Keeling Islands (R. Myers pers. comm. 2009).
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 9
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Size
Max. size
12.2 cm SL (male/unsexed; (Ref. 5278))
-
Randall, J.E. 1992 A review of the labrid fishes of the genus Cirrhilabrus from Japan, Taiwan and the Mariana Islands, with descriptions of two new species. Micronesica 25(1):99-121. (Ref. 5278)
http://www.fishbase.org/references/FBRefSummary.php?id=5278&speccode=5106
Trusted
Type Information
Paratype for Cirrhilabrus rubrimarginatus Randall
Catalog Number: USNM 317970
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & et al.
Year Collected: 1982
Locality: Fiji Islands, Lau Islands, Navutu-I-Ra Island NW Corner of Barrier Reef, Fiji, Fiji Islands, Pacific
Depth (m): 30 to 37
Catalog Number: USNM 317970
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & et al.
Year Collected: 1982
Locality: Fiji Islands, Lau Islands, Navutu-I-Ra Island NW Corner of Barrier Reef, Fiji, Fiji Islands, Pacific
Depth (m): 30 to 37
- Paratype: Randall, J. E. 1992. Micronesica. 25 (1): 114, 2 a,c.
Trusted
Paratype for Cirrhilabrus rubrimarginatus Randall
Catalog Number: USNM 317971
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & J. Libbey
Year Collected: 1982
Locality: Fiji Islands, Totoya Island, First Bay On Lagoon Side of SW End of Island, Fiji, Fiji Islands, Pacific
Depth (m): 30 to 34
Catalog Number: USNM 317971
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & J. Libbey
Year Collected: 1982
Locality: Fiji Islands, Totoya Island, First Bay On Lagoon Side of SW End of Island, Fiji, Fiji Islands, Pacific
Depth (m): 30 to 34
- Paratype: Randall, J. E. 1992. Micronesica. 25 (1): 114, 2 a,c.
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 25 - 52 m (Ref. 37816)
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
This species is found in deep coastal to outer reef drop-offs and steep slopes. It occurs over rubble or sandy bottoms with small isolated patch reefs of low profile. Juveniles are solitary among large rubble, usually in 2-30 m depth. Adults are found in loose aggregations in moderate depths, usually 40 m or more around patch reef.
Systems
- Marine
Trusted
Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 27.5 - 64.05
Temperature range (°C): 26.059 - 26.440
Nitrate (umol/L): 0.282 - 1.349
Salinity (PPS): 34.621 - 35.268
Oxygen (ml/l): 4.247 - 4.660
Phosphate (umol/l): 0.121 - 0.275
Silicate (umol/l): 1.300 - 3.048
Graphical representation
Depth range (m): 27.5 - 64.05
Temperature range (°C): 26.059 - 26.440
Nitrate (umol/L): 0.282 - 1.349
Salinity (PPS): 34.621 - 35.268
Oxygen (ml/l): 4.247 - 4.660
Phosphate (umol/l): 0.121 - 0.275
Silicate (umol/l): 1.300 - 3.048
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 27.5 - 64.05
Temperature range (°C): 26.059 - 26.440
Nitrate (umol/L): 0.282 - 1.349
Salinity (PPS): 34.621 - 35.268
Oxygen (ml/l): 4.247 - 4.660
Phosphate (umol/l): 0.121 - 0.275
Silicate (umol/l): 1.300 - 3.048
Graphical representation
Depth range (m): 27.5 - 64.05
Temperature range (°C): 26.059 - 26.440
Nitrate (umol/L): 0.282 - 1.349
Salinity (PPS): 34.621 - 35.268
Oxygen (ml/l): 4.247 - 4.660
Phosphate (umol/l): 0.121 - 0.275
Silicate (umol/l): 1.300 - 3.048
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 25 - 52m.
From 25 to 52 meters.
Habitat: reef-associated. Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile.
From 25 to 52 meters.
Habitat: reef-associated. Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile.
Trusted
Trophic Strategy
Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile.
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Cirrhilabrus rubrimarginatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGAACAGCCCTTAGCCTTCTAATTCGAGCAGAACTTAGTCAACCAGGCGCACTCCTGGGTGATGATCAAATTTATAACGTAATCGTCACTGCACACGCTTTCGTCATGATTTTCTTCATGGTAATGCCAATCATGATTGGAGGATTTGGAAACTGACTTATTCCCTTAATGATTGGGGCTCCAGACATGGCGTTTCCCCGAATAAACAATATAAGCTTTTGACTTCTTCCCCCCTCCTTCCTACTTCTCCTTGCTTCATCTGGTGTAGAAGCTGGGGCGGGGACGGGCTGGACCGTATATCCCCCTTTAGCGGGCAATCTTGCACATGCCGGCGCCTCTGTAGATCTGACTATCTTTTCCCTTCACCTCGCGGGTATCTCCTCTATCTTAGGTGCTATTAATTTTATTACAACTATTATTAATATAAAACCCCCAGCCATTTCTCAGTACCAGACACCTCTGTTTGTTTGGGCCGTGTTAATTACTGCTGTACTCCTCCTTCTCTCCCTGCCTGTCCTGGCCGCCGGGATTACAATGCTTTTAACTGATCGAAATCTAAACACTACTTTCTTTGACCCTGCTGGAGGTGGAGATCCTATTCTCTACCAACA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Cirrhilabrus rubrimarginatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2010
Assessor/s
Rocha, L.
Reviewer/s
Craig, M.T. & Carpenter, K.E.
Contributor/s
Justification
Even though this species is commercialized in the aquarium trade, it is not commonly traded, and it is common throughout its range. It is listed as Least Concern.
Trusted
Trends
Population
Population
Population Trend
This species is common in some parts of its range. It is considered occasional in Tonga and Vanuatu.
Population Trend
Unknown
Trusted
Threats
Least Concern (LC)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Major Threats
There are no known major threats to this species, although it is exploited in the aquarium trade.
Trusted
Management
Conservation Actions
Conservation Actions
There are no known species specific conservation measures in place. This species range overlaps several marine protected areas within its distribution.
Trusted


