Overview

Comprehensive Description

Biology

Found in deep coastal to outer reef drop-offs and steep slopes. Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile. Juveniles solitary among large rubble, usually in 2-30 m depth. Adults in loose aggregations in moderate depths, usually 40 m or more around patch reef (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: north to the Ryukyu Islands, through the Philippines, Palau, and Indonesia to Vanuatu, Fiji, and Tonga.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is known from the north of the Ryukyu Islands, Japan through the Philippines, Sabah (Malaysia), Palau, and Indonesia to Vanuatu, Fiji, and Tonga. It has also been reported from Cocos-Keeling Islands (R. Myers pers. comm. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific and Cocos-Keeling Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 122 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.2 cm SL (male/unsexed; (Ref. 5278))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Cirrhilabrus rubrimarginatus Randall
Catalog Number: USNM 317970
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & et al.
Year Collected: 1982
Locality: Fiji Islands, Lau Islands, Navutu-I-Ra Island NW Corner of Barrier Reef, Fiji, Fiji Islands, Pacific
Depth (m): 30 to 37
  • Paratype: Randall, J. E. 1992. Micronesica. 25 (1): 114, 2 a,c.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Cirrhilabrus rubrimarginatus Randall
Catalog Number: USNM 317971
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & J. Libbey
Year Collected: 1982
Locality: Fiji Islands, Totoya Island, First Bay On Lagoon Side of SW End of Island, Fiji, Fiji Islands, Pacific
Depth (m): 30 to 34
  • Paratype: Randall, J. E. 1992. Micronesica. 25 (1): 114, 2 a,c.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 25 - 52 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in deep coastal to outer reef drop-offs and steep slopes. It occurs over rubble or sandy bottoms with small isolated patch reefs of low profile. Juveniles are solitary among large rubble, usually in 2-30 m depth. Adults are found in loose aggregations in moderate depths, usually 40 m or more around patch reef.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 27.5 - 64.05
  Temperature range (°C): 26.059 - 26.440
  Nitrate (umol/L): 0.282 - 1.349
  Salinity (PPS): 34.621 - 35.268
  Oxygen (ml/l): 4.247 - 4.660
  Phosphate (umol/l): 0.121 - 0.275
  Silicate (umol/l): 1.300 - 3.048

Graphical representation

Depth range (m): 27.5 - 64.05

Temperature range (°C): 26.059 - 26.440

Nitrate (umol/L): 0.282 - 1.349

Salinity (PPS): 34.621 - 35.268

Oxygen (ml/l): 4.247 - 4.660

Phosphate (umol/l): 0.121 - 0.275

Silicate (umol/l): 1.300 - 3.048
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 25 - 52m.
From 25 to 52 meters.

Habitat: reef-associated. Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs over rubble or sandy bottoms with small isolated patch reefs of low profile.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhilabrus rubrimarginatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCCGGAATAGTTGGAACAGCCCTTAGCCTTCTAATTCGAGCAGAACTTAGTCAACCAGGCGCACTCCTGGGTGATGATCAAATTTATAACGTAATCGTCACTGCACACGCTTTCGTCATGATTTTCTTCATGGTAATGCCAATCATGATTGGAGGATTTGGAAACTGACTTATTCCCTTAATGATTGGGGCTCCAGACATGGCGTTTCCCCGAATAAACAATATAAGCTTTTGACTTCTTCCCCCCTCCTTCCTACTTCTCCTTGCTTCATCTGGTGTAGAAGCTGGGGCGGGGACGGGCTGGACCGTATATCCCCCTTTAGCGGGCAATCTTGCACATGCCGGCGCCTCTGTAGATCTGACTATCTTTTCCCTTCACCTCGCGGGTATCTCCTCTATCTTAGGTGCTATTAATTTTATTACAACTATTATTAATATAAAACCCCCAGCCATTTCTCAGTACCAGACACCTCTGTTTGTTTGGGCCGTGTTAATTACTGCTGTACTCCTCCTTCTCTCCCTGCCTGTCCTGGCCGCCGGGATTACAATGCTTTTAACTGATCGAAATCTAAACACTACTTTCTTTGACCCTGCTGGAGGTGGAGATCCTATTCTCTACCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhilabrus rubrimarginatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
Even though this species is commercialized in the aquarium trade, it is not commonly traded, and it is common throughout its range. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in some parts of its range. It is considered occasional in Tonga and Vanuatu.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known major threats to this species, although it is exploited in the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place. This species range overlaps several marine protected areas within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!