Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A territorial herbivore. Adults inhabit reef flats, shallow lagoons, and semi-sheltered reef margins; common among patches of rubble or porous reef rock, surrounded by live coral, particularly in areas of mild surge (Ref. 1602). Also in high energy zones with mixed corals and short algae. They occur in small loose aggregations (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Allen, G.R. and A.R. Emery 1985 A review of the Pomacentrid fishes of the genus Stegastes from the Indo-Pacific, with descriptions of two new species. Indo-Pac. Fish. (3):31. (Ref. 510)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Seychelles and Reunion to the Line and Tuamoto islands, north to the Ryukyu Islands, south to New Caledonia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Aldabra, Saint Brandon's Shoals and Mascarenes east to Wake Atoll, Line Islands and Tuamotu Archipelago, south to Western Australia, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 15 - 16; Analspines: 2; Analsoft rays: 12 - 14
  • Allen, G.R. and A.R. Emery 1985 A review of the Pomacentrid fishes of the genus Stegastes from the Indo-Pacific, with descriptions of two new species. Indo-Pac. Fish. (3):31. (Ref. 510)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

13.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Body dark brown to blackish; suborbital mostly blue with blue spots on side of head; most scales on side of body with blue transverse streak. Fins dark brown to blackish except pectorals which are translucent with dusky rays. Pectorals with scaly inner base and has pupil-sized black spot at the base of uppermost rays; a black spot (maybe bordered anteriorly with white) at base of posterior dorsal rays, slightly extending onto dorsal edge of caudal peduncle; with or without white bar across posterior half of body (Ref. 510). Body depth 1.8-2.1 in SL (Ref. 90102).
  • Allen, G.R. and A.R. Emery 1985 A review of the Pomacentrid fishes of the genus Stegastes from the Indo-Pacific, with descriptions of two new species. Indo-Pac. Fish. (3):31. (Ref. 510)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A territorial herbivore that inhabits reef flats, shallow lagoons, and semi-sheltered reef margins; common among patches of rubble or porous reef rock, surrounded by live coral, particularly in areas of mild surge (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Stegastes albifasciatus
Catalog Number: USNM 51739
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Stegastes albifasciatus
Catalog Number: USNM 126247
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: American Samoa: Tutuila Island, Pago Pago, Tutuila, American Samoa, Samoa Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 4 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 0.305 - 75
  Temperature range (°C): 25.712 - 29.336
  Nitrate (umol/L): 0.052 - 2.714
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.454 - 4.717
  Phosphate (umol/l): 0.092 - 0.507
  Silicate (umol/l): 1.043 - 4.869

Graphical representation

Depth range (m): 0.305 - 75

Temperature range (°C): 25.712 - 29.336

Nitrate (umol/L): 0.052 - 2.714

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.454 - 4.717

Phosphate (umol/l): 0.092 - 0.507

Silicate (umol/l): 1.043 - 4.869
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). A territorial herbivore that inhabits reef flats, shallow lagoons, and semi-sheltered reef margins; common among patches of rubble or porous reef rock, surrounded by live coral, particularly in areas of mild surge (Ref. 1602). Also in high energy zones with mixed corals and short algae. Occurs in small loose aggregations (Ref. 48636). Browsing on substrate. Sand and algal fragments were common in the guts (Ref. 47011).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stegastes albifasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTCGGTGCCTGGGCCGGAATGGTAGGGACAGCTTTAAGCCTCCTCATTCGGGCAGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAGATTTACAATGTTATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAATTGACTTATCCCCCTAATAATTGGAGCCCCCGACATGGCCTTCCCTCGAATAAACAACATGAGTTTTTGACTCCTACCCCCATCCTTTCTCCTCCTACTTGCTTCTTCAGGCGTTGAAGCAGGTGCAGGAACAGGATGAACTGTATACCCCCCACTTTCTGGCAACTTAGCCCACGCAGGCGCTTCTGTTGACCTGACTATTTTCTCACTCCACCTAGCAGGAATTTCATCCATCCTAGGTGCAATTAATTTTATCACTACAATTATTAATATAAAACCGCCTGCTATCTCCCAATACCAAACCCCACTCTTCGTGTGGGCCGTATTGATTACCGCCGTTCTTCTTCTCCTCTCCCTCCCAGTACTGGCTGCCGGAATTACCATGCTTCTAACGGATCGAAACTTAAACACTACTTTCTTTGACCCCGCAGGAGGAGGAGACCCCATTCTCTATCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stegastes albifasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stegastes albifasciatus

The whitebar gregory, Stegastes albifasciatus, is a damselfish of the family Pomacentridae native to the western Indo-Pacific. Its range extends from the Seychelles and Réunion to the Ryukyu Islands, the Tuamoto Islands, and New Caledonia,[2] where it is found on reef flats, reef margins and lagoons on patches of rubble or reef rock with live corals, particularly in areas of moderate water movement.[1]

References[edit]

  1. ^ a b Bailly, Nicolas (2013). "Stegastes albifasciatus (Schlegel & Müller, 1839)". World Register of Marine Species. Retrieved 2014-01-07. 
  2. ^ "Stegastes albifasciatus (Schlegel & Müller, 1839): Whitebar gregory". FishBase. Retrieved 2014-01-07. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!