Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults are found in inlet waters, occasionally entering brackish waters. Fingerlings are often seen in brackish river mouths (Ref. 58920). Move offshore with growth. Breed in the sea (Ref. 58920) from March to May; attach eggs to rocks in shingly areas at depths of around 20 m. Liver and ovaries extremely toxic, intestines slightly toxic; flesh, skin and testes not poisonous. Juveniles resemble Takifugu niphobles (Ref. 637). A prized food fish in Japan. Said to be commercially cultured in Japan at present. Used in Chinese medicine (Ref. 12166). One of the first vertebrates whose genome has been sequenced completely, 31,059 genes coding for 33,609 proteins (Ref. 58917).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northwest Pacific: western part of the Sea of Japan and the East China and Yellow seas northward to Muroran, Hokkaido, Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 16 - 19; Analspines: 0; Analsoft rays: 13 - 16; Vertebrae: 21 - 22
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 56527))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body covered with prickles; presence of a large round black blotch edged with a white line on side just behind pectoral fin (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; non-migratory; freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inlet waters, occasionally entering brackish waters. Move offshore with growth. Juveniles resemble Takifugu niphobles (Ref. 637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Heterobothrium Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Takifugu rubripes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAATCACAAAGATATCGGCACCCTATACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGCACAGCACTAAGTCTTCTTATTCGGGCCGAACTCAGTCAACCCGGCGCACTCTTGGGCGATGACCAGATCTACAATGTAATCGTTACAGCCCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGGAACTGATTAATCCCACTTATAATCGGAGCCCCAGACATGGCCTTCCCCCGAATGAACAACATAAGCTTCTGACTGCTTCCCCCATCCTTCCTCCTTCTGCTCGCATCCTCTGGAGTAGAAGCCGGAGCGGGTACGGGCTGAACTGTTTACCCACCCCTAGCAGGAAATCTTGCCCACGCAGGGGCTTCTGTAGACCTCACCATCTTCTCTCTTCATCTTGCAGGGGTCTCCTCTATTCTAGGGGCAATCAACTTCATCACAACCATCATTAACATGAAGCCCCCAGCAATCTCACAATACCAAACACCTCTTTTCGTGTGAGCCGTTTTAATTACTGCTGTACTTCTCCTGCTCTCCCTTCCAGTCCTTGCAGCAGGGATTACAATACTTCTCACTGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCTTGTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTCTACATTCTAATTCTCCCTGGCTTCGGAATAATTTCACACATCGTAGCCTACTACTCGGGCAAAAAAGAACCATTCGGCTACATGGGCATGGTCTGAGCCATAATGGCCATCGGTCTTCTTGGTTTTATTGTATGAGCCCACCACATGTTTACAGTCGGCATGGACGTAGACACCCGAGCCTACTTTACCTCTGCCACAATAATTATTGCCATCCCGACAGGAGTCAAAGTATTTAGCTGACTTGCAACCTTGCATGGAGGATCAATTAAATGAGAAACCCCTATACTATGAGCCCTCGGCTTCATCTTCCTATTTACAGTGGGTGGCCTAACCGGAATTGTCCTAGCCAATTCATCCCTAGACATCGTATTACACGACACCTACTACGTAGTTGCCCATTTCCACTACGTCCTCTCCATGGGTGCTGTATTTGCAATTATGGGTGCATTCGTACACTGATTCCCACTATTTTCAGGATACACACTCCACAGCACTTGAACTAAAATCCACTTCGGAGTAATGTTCATTGGTGTCAACCTAACCTTCTTCCCTCAACACTTCCTTGGTCTAGCTGGAATACCTCGACGATACTCCGACTACCCCGACGCCTACGCCCTATGAAACTCCGTCTCCTCAATTGGCTCAATAGTCTCTCTAGTGGCAGTAATTATGTTCCTCTTTATCCTCTGAGAAGCCTTCACCGCTAAGCGAGAAGTCCAATCAGTTGAACTAACAATGACAAATGTAGAATGACTACACGGGTGCCCTCCTCCTTACCACACATTCGAAGAGCCCGCCTTTGTCCAAACTCAAACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Takifugu rubripes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Takifugu rubripes

Takifugu rubripes (the Japanese puffer, Tiger puffer, or torafugu (Japanese: 虎河豚), also known as Fugu rubripes) is a pufferfish in the genus Takifugu. A feature of this species is that it has a very small genome, which is used as a ‘reference’ for identifying genes and other elements in human and other vertebrate genomes. The genome was published in 2002,[1] the first vertebrate genome to be made publicly available after the human genome.

Taxonomy[edit]

Although often known in the genomics literature as Fugu rubripes, the genus Fugu is a synonym of Takifugu,[2] hence the name Takifugu rubripes is currently used for this fish.

References[edit]

  1. ^ Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P, Christoffels A, Rash S, Hoon S, Smit A et al. (2002). "Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes". Science 297: 1301–1310. doi:10.1126/science.1072104. PMID 12142439. 
  2. ^ Keiichi Matsuura (1990). "The pufferfish genus Fugu Abe, 1952, a junior subjective synonym of Takifugu Abe, 1949". Bull. Natn. Sci. Mus., Tokyo, Ser. A. 16: 15–20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!