Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

The pufferfish known as the Torafugu (Takifugu rubripes) has at least two claims to fame. First, the genome of this species was the first vertebrate genome to be sequenced and made publicly available after the human genome. Pufferfish genomes are the smallest known for vertebrates, only around 400 Mb (about an eighth the size of the human genome). Pufferfishes were suggested as appealing "model" vertebrates for genomic analysis in part because, although compact, their genomes have essentially the same genes and regulatory sequences as other vertebrates, so less effort is needed to obtain a comparable amount of information (Brenner et al. 1993). Analysis of the Torafugu genome together with the genomes of another pufferfish,Tetraodon nigroviridis, and other vertebrates have provided new insights into the evolution of vertebrates (e.g., Jaillon et al. 2004). For technical information about the Torafugu genome, visit the Fugu Genome Project webpage.

Torafugus's second claim to fame is as a dangerous delicacy in Japan. Fugu is a Japanese dish prepared in various ways from certain species of pufferfish (Takifugu, Lagocephalus, Sphoeroides) or porcupinefish (Diodon)--but especialy from Ta. rubripes. What makes fugu so exciting and sets it apart from other fish sold in restaurants is that it is potentially deadly. Fugu can contain lethal amounts of the poison tetrodotoxin (TTX) in its organs, especially the liver and ovaries, and also in the skin. The poison paralyzes the muscles while the victim remains fully conscious until eventually dying from asphyxiation. There is no known antidote. Even miniscule traces of the toxin are said to cause the diner’s lips to go numb and turn his mind to the possibility that this could be his last meal. With the stakes so high, chefs must be highly trained to prepare fugu and it is not widely available outside Japan—in fact, it is illegal to sell it in most or all of the European Union and its preparation and sale is tightly regulated in the United States.

Different pufferfish species and different body parts vary substantially in their TTX concentration (Noguchi and Arakawa 2008). Some recent research has indicated that the toxin may be derived from TTX-laden bacteria working their way up the food chain to the pufferfish, making safe-to-eat farmed fugu a possibility (e.g., see Noguchi and Arakawa 2008; Yuan et al. 2011). Some purists, predictably, insist that the taste of farmed fugu cannot compare with the sublime flavor of the wild fish—or could it just be the lack of adrenaline in the diner’s body that tames the flavor of poison-free farmed fugu? Food writer Adam Platt's 2008 account of dining on fugu in Tokyo can be read in New York Magazine.

The genus Takifugu includes around two dozen species, all of which are found in marine waters around China, Korea, and Japan, although additional morphological and genetic analyses are needed to resolve some taxonomic questions (e.g., see Song et al 2001;  Reza et al 2008). Yamanoue et al. (2008) used whole mitochondrial genome sequences from 15 Takifugu species and eight other tetraodontid pufferfishes (plus two outgroups.) to investigate phylogenetics relationships within this Takifugu. Their analyses indicated that Takifugu species are very closely related to each other and speciated over a relatively short period in the limited area of the East Asian marine waters.

  • Brenner, S., G. Elgar, G., R. Sandford, A. Macrae, B. Venkatesh, and S. Aparicio. 1993. Characterization of the pufferfish (Fugu) genome as a compact model vertebrate genome. Nature 366: 265–268.
  • Jaillon, O., J.M. Aury, F. Brunet et al. 2004. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431: 946–57.
  • Noguchi, T. and O. Arakawa. 2008. Tetrodotoxin – Distribution and Accumulation in Aquatic Organisms, and Cases of Human Intoxication. Marine Drugs 6: 220-242.
  • Reza, M.S., S. Furukawa, T. Mochizuki, H. Matsumura, and S. Watabe. 2008. Genetic comparison between torafugu Takifugu rubripes and its closely related species karasuTakifugu chinensis. Fisheries Science 74: 743-754.
  • Song, L., B. Liu, J. Xiang, and P.-Y. Quian. 2001. Molecular Phylogeny and Species Identification of Pufferfish of the Genus Takifugu (Tetraodontiformes, Tetraodontidae). Marine Biotechnology 3: 398–406.
  • Yamanoue,Y., M. Miya, K. Matsuura. et al. 2009. Explosive Speciation of Takifugu: Another Use of Fugu as a Model System for Evolutionary Biology. Molecular Biology and Evolution 26(3):623–629.
  • Yuan, J.,Y. Liu, Q.-L. Gong, L. Zhou, and Z.-P. Wang. 2011. Toxicity of cultured puffer fish and seasonal variations in China. Aquaculture Research 42: 1186-1195.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Adults are found in inlet waters, occasionally entering brackish waters. Fingerlings are often seen in brackish river mouths (Ref. 58920). Move offshore with growth. Breed in the sea (Ref. 58920) from March to May; attach eggs to rocks in shingly areas at depths of around 20 m. Liver and ovaries extremely toxic, intestines slightly toxic; flesh, skin and testes not poisonous. Juveniles resemble Takifugu niphobles (Ref. 637). A prized food fish in Japan. Said to be commercially cultured in Japan at present. Used in Chinese medicine (Ref. 12166). One of the first vertebrates whose genome has been sequenced completely, 31,059 genes coding for 33,609 proteins (Ref. 58917).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northwest Pacific: western part of the Sea of Japan and the East China and Yellow seas northward to Muroran, Hokkaido, Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 16 - 19; Analspines: 0; Analsoft rays: 13 - 16; Vertebrae: 21 - 22
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 56527))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body covered with prickles; presence of a large round black blotch edged with a white line on side just behind pectoral fin (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; non-migratory; freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inlet waters, occasionally entering brackish waters. Move offshore with growth. Juveniles resemble Takifugu niphobles (Ref. 637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Heterobothrium Infection. Parasitic infestations (protozoa, worms, etc.)
  • Leong, T.S. 1992 Diseases of brackishwater and marine fish cultured in some Asian countries. p. 223-236. In M. Shariff, R.P. Subasinghe and J.R. Arthur (eds.) Proceedings of the First Symposium on Diseases in Asian Aquaculture. Asian Fisheries Society, Manila, Philippines. (Ref. 48652)   http://www.fishbase.org/references/FBRefSummary.php?id=48652&speccode=80 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Takifugu rubripes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAATCACAAAGATATCGGCACCCTATACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGCACAGCACTAAGTCTTCTTATTCGGGCCGAACTCAGTCAACCCGGCGCACTCTTGGGCGATGACCAGATCTACAATGTAATCGTTACAGCCCATGCATTCGTAATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGGAACTGATTAATCCCACTTATAATCGGAGCCCCAGACATGGCCTTCCCCCGAATGAACAACATAAGCTTCTGACTGCTTCCCCCATCCTTCCTCCTTCTGCTCGCATCCTCTGGAGTAGAAGCCGGAGCGGGTACGGGCTGAACTGTTTACCCACCCCTAGCAGGAAATCTTGCCCACGCAGGGGCTTCTGTAGACCTCACCATCTTCTCTCTTCATCTTGCAGGGGTCTCCTCTATTCTAGGGGCAATCAACTTCATCACAACCATCATTAACATGAAGCCCCCAGCAATCTCACAATACCAAACACCTCTTTTCGTGTGAGCCGTTTTAATTACTGCTGTACTTCTCCTGCTCTCCCTTCCAGTCCTTGCAGCAGGGATTACAATACTTCTCACTGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCTTGTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTCTACATTCTAATTCTCCCTGGCTTCGGAATAATTTCACACATCGTAGCCTACTACTCGGGCAAAAAAGAACCATTCGGCTACATGGGCATGGTCTGAGCCATAATGGCCATCGGTCTTCTTGGTTTTATTGTATGAGCCCACCACATGTTTACAGTCGGCATGGACGTAGACACCCGAGCCTACTTTACCTCTGCCACAATAATTATTGCCATCCCGACAGGAGTCAAAGTATTTAGCTGACTTGCAACCTTGCATGGAGGATCAATTAAATGAGAAACCCCTATACTATGAGCCCTCGGCTTCATCTTCCTATTTACAGTGGGTGGCCTAACCGGAATTGTCCTAGCCAATTCATCCCTAGACATCGTATTACACGACACCTACTACGTAGTTGCCCATTTCCACTACGTCCTCTCCATGGGTGCTGTATTTGCAATTATGGGTGCATTCGTACACTGATTCCCACTATTTTCAGGATACACACTCCACAGCACTTGAACTAAAATCCACTTCGGAGTAATGTTCATTGGTGTCAACCTAACCTTCTTCCCTCAACACTTCCTTGGTCTAGCTGGAATACCTCGACGATACTCCGACTACCCCGACGCCTACGCCCTATGAAACTCCGTCTCCTCAATTGGCTCAATAGTCTCTCTAGTGGCAGTAATTATGTTCCTCTTTATCCTCTGAGAAGCCTTCACCGCTAAGCGAGAAGTCCAATCAGTTGAACTAACAATGACAAATGTAGAATGACTACACGGGTGCCCTCCTCCTTACCACACATTCGAAGAGCCCGCCTTTGTCCAAACTCAAACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Takifugu rubripes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Takifugu rubripes

Takifugu rubripes (also known as Fugu rubripes) is a pufferfish in the genus Takifugu. A feature of this species is that it has a very small genome, which is used as a ‘reference’ for identifying genes and other elements in human and other vertebrate genomes. The genome was published in 2002,[1] the first vertebrate genome to be made publicly available after the human genome.

Taxonomy

Although often known in the genomics literature as Fugu rubripes, the genus Fugu is a synonym of Takifugu,[2] hence the name Takifugu rubripes is currently used for this fish.

References

  1. ^ Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P, Christoffels A, Rash S, Hoon S, Smit A, et al. (2002). "Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes". Science 297: 1301–1310. doi:10.1126/science.1072104. PMID 12142439. 
  2. ^ Keiichi Matsuura (1990). "The pufferfish genus Fugu Abe, 1952, a junior subjective synonym of Takifugu Abe, 1949". Bull. Natn. Sci. Mus., Tokyo, Ser. A. 16: 15–20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!