Overview

Comprehensive Description

Biology

A benthic and solitary species (Ref. 26340) occurring along rocky shorelines, reefs, and mangroves (Ref. 3255).Usually found shallower than 30 m (Ref. 26938). Due to its large size and aggressiveness, the bites of this moray are particularly dangerous (Ref. 3255). Feeds mainly at night on fish and crustaceans (Ref. 42064). Marketed fresh and salted (Ref. 3255). Large individuals are ciguatoxic (Ref. 3255).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

New Jersey to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: New Jersey (USA), Bermuda, and northern Gulf of Mexico to Brazil. Recorded once from Nova Scotia, Canada. Eastern Atlantic and eastern Pacific (Ref. 26340).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Gymnothorax funebris, green moray eels, can be found in the western Atlantic Ocean, including the Gulf of Mexico and the Caribbean Sea. Typically, these moray eels range as far north as New Jersey and as far south as Brazil. One individual was reported off the coast of Nova Scotia. Experts speculate that this animal had been carried there by the Gulf Stream. The species is most common in the Gulf of Mexico, the Caribbean Sea, the Bahamas, and the Florida Keys. These eels make small migrations to spawning sites.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); atlantic ocean (Native )

  • 2003. Gymnothorax funebris. Pp. 254-258; 266-267 in M Hutchins, D Thoney, P Loiselle, N Schlager, eds. Grzinek's Animal Life Encyclopedia, Vol. 4, 2 Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body of Gymnothorax funebris is long and laterally compressed. This animal has no scales on its dark brown/grey skin, the entirety of which is covered by a yellow mucus. This mucus serves to protect these eels from parasites and bacteria. The yellow color of the mucus, when mixed with the brown or grey color of the eel's skin, results in a green hue, for which the animal is named. Green morays, like all eels, have no pelvic fins and, like all morays, have no pectoral fins. Their dorsal fin runs the length of the body and is continuous with the caudal fin. On the face there are two cylindrical structures- its incurrent nostrils. The excurrent nostrils are marked by simple openings. The teeth are large and smooth-edged. On the upper jaw, there are two rows of teeth, while on the bottom, there is only one. The largest specimen ever recorded was 2.5 m from nose to tail, with a mass of 29 kg. The average individual is estimated to be 1.8 m from nose to tail and have a mass of 13.3 kg.

Range mass: 29 (high) kg.

Average mass: 13.3 kg.

Range length: 2.5 (high) m.

Average length: 1.8 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Nelson, J. 1984. Fishes of the World. Toronto: John Wiley & Sons, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 29.0 kg (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Very large brown moray, uniformly dark green to brown (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurring along rocky shorelines, reefs, and mangroves.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 50 m (Ref. 58047), usually 5 - 30 m (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Green morays live in rocky, intertidal areas, coral reefs, mangroves, tidal creeks, harbors, seagrass beds, and other areas over sandy or muddy bottoms. They reside in rock crevices and small caves, usually no deeper than 30 m.

Range depth: 1 to 30 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Other Habitat Features: estuarine ; intertidal or littoral

  • Moyle, P., J. Cech. 1982. Fishes: An Introduction to Ichthyology. Englewood Cliffs, NJ: Prentice-Hall, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 40 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.275 - 14.7
  Temperature range (°C): 24.554 - 27.724
  Nitrate (umol/L): 0.162 - 0.997
  Salinity (PPS): 34.217 - 36.061
  Oxygen (ml/l): 4.480 - 4.733
  Phosphate (umol/l): 0.006 - 0.429
  Silicate (umol/l): 1.497 - 4.423

Graphical representation

Depth range (m): 0.275 - 14.7

Temperature range (°C): 24.554 - 27.724

Nitrate (umol/L): 0.162 - 0.997

Salinity (PPS): 34.217 - 36.061

Oxygen (ml/l): 4.480 - 4.733

Phosphate (umol/l): 0.006 - 0.429

Silicate (umol/l): 1.497 - 4.423
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 5m.
Recorded at 5 meters.

Habitat: reef-associated. Occurs in coral reefs and dirty harbours (around pilings, wharves and seawalls). Due to its large size and aggressiveness, the bites of this moray are particularly dangerous. Large individuals are ciguatoxic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cleaned by goby (Gobiosoma evelynae and others) as observed on the coral reefs in Bonaire, Netherlands Antilles (Ref. 36810). Also cleaned by Elacatinus randalli at Fernando de Noronha Archipelago, western south Atlantic (Ref. 40094).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Gymnothorax funebris is a dietary generalist. It readily consumes most species of fish, so long as they are small enough to swallow whole or can be ripped into manageable pieces. Green morays will also prey on crustaceans and cephalopods. Larvae prey on diatoms, smaller crustaceans, and other zooplankton.

Animal Foods: fish; mollusks; aquatic crustaceans; zooplankton

Other Foods: microbes

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Very little is known about the role of Gymnothorax funebris in its ecosystem, beyond that it is a top predator. Reportedly, some maintain a mutualistic relationship with gobies, wrasses, and some shrimp, all of which eat microbes off of the eel's skin.

Mutualist Species:

  • gobies
  • wrasses
  • shrimp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

As larvae, green morays are eaten by most any animal that consumes zooplankton. As for adults, little information has been recorded about their predators. Presumably, large individuals would have very few natural predators, since they are relatively large and will viciously attack any potential threats.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds mainly at night on fish and crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Because of their solitary lifestyle, these animals rarely have occasion to communicate with conspecifics. Little is known about how they communicate with potential mates. Their senses, the strongest of which is smell, are dedicated to locating food and a spawning site.

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spawning migrations and leptocephalus larvae (ref. 42064).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

When the fertilized eggs of green morays hatch, prolarvae emerge. Shortly thereafter the prolarvae transform into leptocephalus larvae, which grow to be between 5 and 10 cm in length. The leptocephalus larva shares a number of morphological characteristics with its adult counterparts: both are long and laterally compressed and their dorsal, caudal and anal fins are continuous. Unlike adults, they have a "gelatinous" consistency and their tissues (with the exception of bone) are transparent.

The leptocephalus larva will undergo its final metamorphosis in open water. The juvenile resembles the mature animal, save that it is smaller in size. Ocean currents disperse the animals after metamorphosis and, once they have reached a permanent habitat, they mature. This process not only involves an increase in size, but two stages of sexual maturity: a hermaphroditic stage as a juvenile (during which individuals posess both male and female sex organs) before a determined male or female stage as an adult. Experts speculate that environment plays a role in the final sex determination, with more stressful environments producing more females. Based on the documented larval development of the European eel,the larval stage of the green moray probably lasts on the order of 2.5 years.

Development - Life Cycle: metamorphosis

  • Bertin, L. 1957. Eels: A Biological Study. New York, NY: Philosophical Library, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of Gymnothorax funebris is not well known. There are records of other Anguilliformes with life spans between 8 and 30 years of age in the wild. One captive specimen lived to be 85 years of age.

  • Moriarty, C. 1978. Eels: A Natural and Unnatural History. New York, NY: Universe Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of Gymnothorax funebris has yet to be described. We do know that fertilization occurs externally and at a spawning site. Based on what is known about European eels (Anguilla anguilla), it is plausible that green morays are promiscuous and that spawning sites are farther from the shoreline than the eel's foraging habitat, between 400 m and 500 m deep.

Mating System: polygynandrous (promiscuous)

The reproductive habits of Gymnothorax funebris are not well known. There is no record of when these animals spawn, though close relatives are known to spawn in the early months of the year, around January or February. At a given spawning site, millions of eggs are released, but significantly less are fertilized and fewer still (on the order of one in every six million) survive into adulthood.

Breeding interval: It is unknown how frequently green morays breed.

Breeding season: Green morays may breed in the early months of the year; in January or February

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

After they have spawned, adult eels leave the area to die or return to their home range. There is no parental involvement after the eggs have been fertilized.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Bertin, L. 1957. Eels: A Biological Study. New York, NY: Philosophical Library, Inc..
  • 2003. Gymnothorax funebris. Pp. 254-258; 266-267 in M Hutchins, D Thoney, P Loiselle, N Schlager, eds. Grzinek's Animal Life Encyclopedia, Vol. 4, 2 Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gymnothorax funebris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gymnothorax funebris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATTTAGTATTTGGTGCTTGAGCCGGAATGGTCGGTACCGCCCTGAGCCTTCTTATTCGTGCTGAGCTTAGCCAGCCAGGGGCTCTCCTAGGTGACGACCAAATTTACAACGTTATCGTAACAGCTCATGCCTTTGTAATAATCTTCTTTATAGTAATACCCGTCATGATTGGGGGATTTGGAAACTGACTTATTCCACTAATGATCGGAGCCCCTGACATAGCATTCCCGCGAATGAACAACATAAGCTTCTGGCTCCTACCCCCCTCTTTTCTATTATTGCTAGCCTCATCTGGTGTAGAGGCTGGAGCAGGAACCGGGTGGACTGTATACCCGCCTCTTGCAGGAAACCTGGCCCATGCTGGAGCATCCGTTGATTTAACCATTTTCTCCCTCCACTTGGCAGGTGTGTCATCAATTTTAGGAGCAATCAATTTTATTACAACCATTATTAACATAAAACCCCCAGCTATCACACAATACCAGACACCTCTGTTTGTTTGGGCAGTGTTGGTTACGGCCGTGCTTCTTCTGCTCTCTCTACCTGTACTGGCAGCTGGCATTACAATGCTTTTAACCGATCGGAATCTTAACACAACTTTCTTTGACCCTGCCGGAGGAGGTGACCCAATTCTGTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Green moray eels are not currently threatened.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

These animals are feared for their vicious bite. However, it is worth noting that they rarely bite unless provoked. Also, large individuals are potentially ciguatoxic (a common toxin found in large fish between 35 degrees N and 34 degrees S latitude). Some of the eel's prey consume dinoflagellates that produce ciguatoxins. The toxin concentrates as it moves up the food chain. As a result, it is particularly dangerous to humans who eat large top predators from these ecosystems.

Negative Impacts: injures humans (bites or stings, carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Green morays are objects of great interest to divers and tourists at coral reefs and other natural habitats. Commercially, they are sold as pets to private aquarists with adequate facilities to keep them. They are also common in public aquaria. Less often, they are sold as food.

Positive Impacts: pet trade ; food ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green moray

"Green moray (eel)" is also sometimes used for the yellow moray, G. prasinus.

The green moray, Gymnothorax funebris, is a moray eel of the family Muraenidae, found in the western Atlantic from New Jersey, Bermuda, and the northern Gulf of Mexico to Brazil, at depths down to 40 m. Its length is up to 2.5 m.












































Green moray

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!