Overview

Comprehensive Description

Biology

Inhabits rocky pools and adjacent riffles of clear creeks and small fast rivers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (5000-200,000 square km (about 2000-80,000 square miles)) Range includes the middle and upper Tennessee River drainage (above the Duck River) in Tennessee, Alabama, Georgia, North Carolina, Virginia, and Mississippi (Lee et al. 1980, Page and Burr 2011).

Extent of occurrence is around 20,000 square kilometers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range includes the middle and upper Tennessee River drainage (above the Duck River) in Tennessee, Alabama, Georgia, North Carolina, Virginia, and Mississippi (Lee et al. 1980, Page and Burr 2011).

Extent of occurrence is around 20,000 square kilometers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: occurs only in the middle and upper Tennessee River drainage (Bear Creek in Alabama, and upstream) of Virginia, North Carolina, Tennessee, Georgia and Alabama in the USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 5 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 68 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.8 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes rocky pools and adjacent riffles of clear creeks and small fast rivers with sand and gravel substrate and moderate gradient (Lee et al. 1980, Page and Burr 2011), commonly in slow to moderate flow, in shallow margins of pools and runs (Burkhead and Jenkins 1991), in streams characterized in general by moderate to swift flow. Spawning apparently occurs in deeper riffles than those used by E. stigmaeum (Kuehne and Barbour 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes rocky pools and adjacent riffles of clear creeks and small fast rivers with sand and gravel substrate and moderate gradient (Lee et al. 1980, Page and Burr 2011), commonly in slow to moderate flow, in shallow margins of pools and runs (Burkhead and Jenkins 1991), in streams characterized in general by moderate to swift flow. Spawning apparently occurs in deeper riffles than those used by Etheostoma stigmaeum (Kuehne and Barbour 1983).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: his species is represented by a fairly large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 10,000. This species is generally common (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Apparently spawns in March and April.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etheostoma jessiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCCTAAGCTTAATAATCCGAGCCGAATTAAGCCAACCCGGCGCACTCTTAGGGGACGATCAGATTTATAACGTAATTGTTACAGCACACGCCTTTGTAATGATCTTCTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAACTGACTTGTGCCACTTATGATTGGTGCCCCTGACATGGCATTCCCTCGAATAAACAACATGAGCTTTTGACTCCTTCCCCCCTCTTTCCTCCTACTTCTTGCCTCCTCTGGAGTAGAAGCTGGGGCTGGGACTGGGTGGACCGTTTATCCCCCACTGGCTGGGAACTTAGCGCATGCCGGGGCATCCGTTGATCTAACTATTTTTTCCCTCCACCTAGCAGGAATCTCTTCTATTCTAGGAGCCATCAACTTTATCACAACTATTATTAACATAAAACCCCCGGCTATTTCCCAATACCAAACGCCCCTGTTTGTATGAGCCGTCCTGATCACCGCCGTGCTTCTCCTTCTCTCCCTCCCCGTGCTTGCAGCAGGTATTACGATACTTCTTACAGATCGAAACCTAAACACCACTTTCTTTGATCCCGCAGGAGGGGGAGACCCGATCCTTTACCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Etheostoma jessiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Least Concern because its extent of occurrence, number of subpopulations, and population size are relatively large, and because the species is probably not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past three generations is uncertain but probably relatively stable or slowly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a fairly large number of occurrences (subpopulations).

Total adult population size is unknown but presumably exceeds 10,000. This species is generally common (Page and Burr 2011).

Trend over the past three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: In some areas, this species is threatened by siltation and possibly agricultural runoff (Burkhead and Jenkins 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
In some areas, this species is threatened by siltation and possibly agricultural runoff (Burkhead and Jenkins 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blueside darter

The blueside darter, Etheostoma jessiae, is usually found in the Tennessee River drainage in Tennessee, Alabama, North Carolina, and Virginia, and less commonly found in Bear Creek, Shoal Creek, and Barren Fork.[2]

The specific name jessiae refers to Jessie Brayton, wife of the junior author of the species.[2]

Introduction

This is a description of a monitoring plan for the blueside darter (Etheosstoma jessiae). Etheostoma are a genus of small freshwater fish commonly referred to as Darters. Darters occur throughout the Tennessee River drainage, excluding the upper Clinch and Powell Rivers from Whiteoak Creek, Humphreys county, TN, upstream into the French Broad River system, NC,[3][4][5] The blueside darter is a remember of the subgenus Doration. Originally all darters in this subgenus were identified as a single species, but this group has been described as being a highly variable species thus the species has been differentiated into five spate species, the blueside darter being on e of the newer species [6]

The blueside darter has a long, pointed snout with a narrow frenum on the upper lip, a relatively large mouth, and a deep blue body (compared to turquoise-blue). The male blueside darters have 9-10 W-shaped bars along their sides, which appear as solid blue square blotches confined to the lateral area during the spawning season. The dorsal side of the blueside darter has six hourglass-shaped saddles and is diffusely speckled. They have a spiny dorsal fin with a blue band and a wide orange band immediately dorsal to it. The soft dorsal, caudal, and pectoral fins are dusky with distinct orange stippling in all rays. Iridescent blue is restricted to the pre-opercle and lower opercles. Males are very brightly colored during breeding season [4]

Currently the blueside darter is listed as a species of least concern because its range of occurrence, number of subpopulations, and population size are relatively large, and because the species is probably not declining fast enough to qualify for any of the threatened categories [1] The total adult population size is unknown but surpasses 10.000 individuals [7] However, in some parts of its range the population is slowly declining due to anthropogenic factors such as siltation, agricultural runoff, and water pollution [8][9] Reintroductions and water quality improvement measures have been underway in areas where population trends are dwindling [9]

Geographic Distribution

The range of the blueside darter is maintained in the Southeastern portion of North America [3] The bluside darter in habits most of the middle and upper Tennessee River drainage in Tennessee, Alabama, Georgia, North Carolina, Virginia, and Mississippi [10][7] It has also been reported in scattered collections in Bear, Barren Fork, Second, and Shoal creek systems, which are all tributaries of the Tennessee River [4] The extent of the occurrence is approximately 20,000 square kilometers [7]

Ecology

The blueside darter thrives in benthopelagic freshwater systems [3][3][4] Their preferred habitat is in rocky pools and adjacent rifles of clear creeks and small fast rivers with sand and gravel substrate and moderate gradient,[7][11] and commonly in slow to moderate flow, in shallow margins of pools and runs,[8][9] as well as n streams characterized in general by moderate to swift flows. The differences in substrate are dependent upon depth and movement of water so it is difficult to determine whether substrate or water flow is a defining characteristic in habitat choice [9]

A study completed by Schilling in 2009 conveyed that blueside darters seemed to maintain a fairly shallow depth in the water column with a maximum depth of 60 cm. Due to the seasonal variations in the regions where blueside darters occur, temperatures vary depending on the time of year and do not limit micro-habitat selection [9] The Schilling experiment also indicated that the blueside darter did show tolerance to conductivity changes with an average pH for micro-sites being slightly basic which is indicative to limestone rock substrate. Populations have been relatively stable in most areas where the blueside occurs however, in a few areas scientists have noted a downward trend in population sizes [10][9] Anthropogenic factors that may be to blame for this decline are water pollution, run-off from agriculture, and siltation [8][9]

Life History

Most darters have specific habitat requirements regarding substrate composition, water velocity, and water depth [12] Harrison (2004) suggested that darters have specialized reproductive behaviors which may make suitable spawning habitat limiting factor. The blueside darter spawns once a year when water temperatures reach 21° - 23°C roughly during March through May throughout the range [4][10][12] however in TN spawning starts between mid-February and mid-March with reproduction occurring April to early May [5][12] Spawning occurs in deeper riffles than those used by Etheostoma stigmaeum. Female blueside darters show increased fecundity as they grow longer in length. At 1 year of age large females are sexually mature but there is limited data on male sexual maturity [5]

Darters have two spawning behaviors; they either bury the eggs in the substrate or attach the eggs to an object. Blueside darters bury their eggs in riffle habitats with fine or course gravel sand substrate in moderate current. The male pursues a female and mounts her and she lays 3-5 eggs in the gravel [5][12] The eggs hatch after around 8–10 days after an incubation temperature of 21° - 23°C [5] Blueside darter diet consists of midge larvae, microcrustaceans, and mayfly nymphs [5] The males have been known to produce Schreckstoff substances that serve to warn nearby fish in case of an attack.

Current Management

One area where populations have been declining due to toxic effluents is the Pigeon River which begins in Haywood County, North Carolina, and flows into the French Broad River in Tennessee [13] A paper plant began releasing toxins into the water in 1908 which led to degradation of not only the Pigeon River but the toxins flowed 79 miles downstream into the French Broad River system.[13] The water pollution extirpated several species of mollusks and fish including the blueside darter [14]

Champion Paper International, currently called Blue Ridge Paper Products, has since made changes to the plant to improve water quality but has not entirely eliminated all the pollution [13] Of the 24 non-game species that were extirpated from the Pigeon and French Broad River systems due to water pollution from the paper plant, 8 species have been re-introduced by the Pigeon River Recovery Project. In the southeastern United States, there have been few re-introductions and even fewer attempts to monitor their success [12] The projects goal has been to reintroduce as many of those extirpated species as possible into locations where successful restoration is favorable [14]

Management Recommendations

A recommendation for future management of the blueside darter is to initiate transporting individuals from other locations into areas where the populations have been reduced or extirpated. However, since some darter populations are too small to remove and not easy to find, initiating captive propagation of the species may be the best alternative management plan. Results from previous management programs have had successful results with captive propagation and they have provided crucial information on the species habitat requirements and spawning behaviors and requirements. Captive propagation may be the most critical management tool in order to re-establish populations of these small non-game fish.

References[edit]

  1. ^ a b NatureServe (2013). "Etheostoma jessiae". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved November 22, 2013. 
  2. ^ a b http://www.outdooralabama.com/fishing/freshwater/fish/other/darters/blueside/
  3. ^ a b c d Encyclopedia of Life. Available from [1]. Accessed 10 Oct 2013.
  4. ^ a b c d e Mettee, M., O'Neil, P., & Malcolm, J. Department of Conservation and Natural Resources, (2008). Blueside darter. Retrieved from website: [2]
  5. ^ a b c d e f Simon, T., & Wallus, R.(2005). Reproductive biology and early life history of fishes in the Ohio river drainage: Percidae - perch, pikeperch, and darters, volume 4. (Vol. 4, pp. 225-233). CRC Press.
  6. ^ Simon, T. (1997). Ontogeny of the darter subgenus doration with comments on intrasubgeneric relationships. Copeia, 1997(1), 60-69. Retrieved from [3].
  7. ^ a b c d Page, L.M. and Burr, B.M. 2011. Peterson field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Harcourt, Boston, Massachusetts, USA.
  8. ^ a b c Burkhead, N.M. and Jenkins, R.E. 1991. Fishes. In: K. Terwilliger (ed.), Virginia's Endangered Species: Proceedings of a Symposium, pp. 321-409. McDonald and Woodward Publishing Company, Blacksburg, Virginia.
  9. ^ a b c d e f g Schilling, D. (2009). Micro-habitat analysis of the blueside darter (etheostoma jessiae). Informally published manuscript, University of Tennessee , University of Tennessee, Knoxville, TN, Retrieved from [4].
  10. ^ a b c NatureServe 2013. Etheostoma jessiae. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. [<www.iucnredlist.org>]. Downloaded on 14 October 2013.
  11. ^ Carlisle, D. M., Hawkins, C. P., Meador, M. R., Potapova, M., & Falcone, J. (2008). Biological assessments of appalachian streams based on predictive models for fish, macroinvertebrate, and diatom assemblages. Ecology, 27(1), 16-37. Retrieved from [5].
  12. ^ a b c d e Harrison, V. (2004). The movements and reproductive success of re-introduced darters in the pigeon river, tn. (Master's thesis) Retrieved from [6].
  13. ^ a b c Bartlett, R. A. 1995. Troubled Waters: Champion International and the Pigeon River Community. University of Tennessee Press. Knoxville, TN. 17-19 pp.
  14. ^ a b Coombs, J.A., L. Wilson, J. Burr, B. Tracy, and V. Harrison. 2004. Pigeon River Revival. Wildlife in North Carolina 68(12): 26-29.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species hybridizes with Etheostoma stigmaeum in Little Bear Creek, Franklin County, Alabama. Burkhead and Jenkins (1991) treated Etheostoma jessiae as a subspecies of E. stigmaeum and noted that the E. stigmaeum group was under taxonomic study at the University of Alabama. Page and Burr (1991, 2011) and the 1991 amd 2004 AFS checklists (Robins et al. 1991, Nelson et al. 2004) accepted E. jessiae as a distinct species. Stones River population may represent an undescribed sibling form (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!