Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coastal waters near reefs and weedy areas (Ref. 30573). Adults usually on silty reefs at moderate depths, or in current channels occasionally inshore; juveniles enter estuaries and harbors (Ref. 48635). Feeds on small fishes and crustaceans (Ref. 5213). Good food fish, marketed fresh.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea south to Transkei, South Africa and east to Papua New Guinea, north to southern Japan, south to western Australia and New South Wales (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Transkei (South Africa), Madagascar and Mauritius (Mascarenes) east to Philippines and Vanuatu, south to Western Australia and New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 20 - 22; Analspines: 3; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 2799))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found over coral reefs in coastal areas. Feeds on small fishes and crustaceans (Ref. 5213). Caught by hand-line and set net; good food fish, marketed fresh.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Golden lines on side of head; body of adults (specimens >50 cm) plain, pattern on body of juveniles change from lines to a reticulate pattern, then golden spots before finally disappearing (Ref. 2799). Juveniles stripes, the stripes breaking up with age and gradually change to the adult pattern (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 4 - ? m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1.1 - 100
  Temperature range (°C): 25.344 - 26.055
  Nitrate (umol/L): 0.164 - 0.176
  Salinity (PPS): 35.057 - 35.071
  Oxygen (ml/l): 4.670 - 4.701
  Phosphate (umol/l): 0.194 - 0.232
  Silicate (umol/l): 3.678 - 3.763

Graphical representation

Depth range (m): 1.1 - 100

Temperature range (°C): 25.344 - 26.055

Nitrate (umol/L): 0.164 - 0.176

Salinity (PPS): 35.057 - 35.071

Oxygen (ml/l): 4.670 - 4.701

Phosphate (umol/l): 0.194 - 0.232

Silicate (umol/l): 3.678 - 3.763
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coastal waters near reefs and weedy areas. Feeds on small fishes and crustaceans (Ref. 5213).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plectorhinchus flavomaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACAGCCCTAAGCCTGCTCATCCGAGCAGAACTAAGCCAGCCCGGCGCTCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCGCATGCGTTTGTAATAATTTTCTTCATAGTGATACCTATCCTCATTGGAGGGTTCGGAAACTGACTGGTTCCACTAATGATTGGAGCACCTGATATAGCCTTCCCGCGAATAAATAATATGAGCTTCTGGCTGCTCCCCCCATCTTTCCTTCTCCTACTTGCCTCTTCAGGAGTTGAGGCTGGGGCAGGGACTGGCTGAACAGTTTATCCCCCACTAGCCGGCAACTTAGCACACGCAGGGGCATCTGTCGACCTCACAATTTTCTCCCTACACTTAGCAGGTGTTTCCTCAATTCTAGGGGCCATCAACTTTATCACGACAATTATTAACATGAAACCCCCAGCCATTTCACAGTATCAGACCCCTCTGTTCGTCTGATCAGTATTAGTTACCGCCGTTCTTCTTCTCCTATCTCTCCCAGTCCTAGCTGCCGGGATTACAATGCTCCTCACAGATCGAAATCTCAACACCACCTTCTTTGATCCAGCAGGAGGAGGGGATCCAATCCTTTACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Plectorhinchus flavomaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!