Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coastal waters near sheltered reefs, lagoons, and weedy areas, solitarily or in groups (Ref. 30573, 90102). Adults usually on silty reefs at moderate depths, or in current channels occasionally inshore; juveniles enter estuaries and harbors (Ref. 48635). Feeds on small fishes and crustaceans (Ref. 5213). Good food fish, marketed fresh.
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea south to Transkei, South Africa and east to Papua New Guinea, north to southern Japan, south to western Australia and New South Wales (Ref. 9710).
  • Smith, M.M. and R.J. McKay 1986 Haemulidae. p. 564-571. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Transkei (South Africa), Madagascar and Mauritius (Mascarenes) east to Philippines and Vanuatu, south to Western Australia and New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 20 - 22; Analspines: 3; Analsoft rays: 7
  • Smith, M.M. and R.J. McKay 1986 Haemulidae. p. 564-571. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 2799))
  • Smith, M.M. and R.J. McKay 1986 Haemulidae. p. 564-571. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Body grey, dorsal spots orange small extending to dorsal and caudal fins; head with lines golden, orange or blue (Ref. 90102). Body of large adults (specimens >50 cm) plain, pattern on body of juveniles change from lines to a reticulate pattern, then golden spots before finally disappearing (Ref. 2799). Juveniles stripes break up with age and gradually change to the adult pattern (Ref. 48635). Body depth 2.5-2.8 in SL. Dorsal 4th or 5th spines longest. Caudal fin slightly rounded in juveniles becoming emarginate in adults. (Ref. 90102).
  • Smith, M.M. and R.J. McKay 1986 Haemulidae. p. 564-571. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Found over coral reefs in coastal areas. Feeds on small fishes and crustaceans (Ref. 5213). Caught by hand-line and set net; good food fish, marketed fresh.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 25 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 1.1 - 100
  Temperature range (°C): 25.344 - 26.055
  Nitrate (umol/L): 0.164 - 0.176
  Salinity (PPS): 35.057 - 35.071
  Oxygen (ml/l): 4.670 - 4.701
  Phosphate (umol/l): 0.194 - 0.232
  Silicate (umol/l): 3.678 - 3.763

Graphical representation

Depth range (m): 1.1 - 100

Temperature range (°C): 25.344 - 26.055

Nitrate (umol/L): 0.164 - 0.176

Salinity (PPS): 35.057 - 35.071

Oxygen (ml/l): 4.670 - 4.701

Phosphate (umol/l): 0.194 - 0.232

Silicate (umol/l): 3.678 - 3.763
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal waters near reefs and weedy areas. Feeds on small fishes and crustaceans (Ref. 5213).
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plectorhinchus flavomaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACAGCCCTAAGCCTGCTCATCCGAGCAGAACTAAGCCAGCCCGGCGCTCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCGCATGCGTTTGTAATAATTTTCTTCATAGTGATACCTATCCTCATTGGAGGGTTCGGAAACTGACTGGTTCCACTAATGATTGGAGCACCTGATATAGCCTTCCCGCGAATAAATAATATGAGCTTCTGGCTGCTCCCCCCATCTTTCCTTCTCCTACTTGCCTCTTCAGGAGTTGAGGCTGGGGCAGGGACTGGCTGAACAGTTTATCCCCCACTAGCCGGCAACTTAGCACACGCAGGGGCATCTGTCGACCTCACAATTTTCTCCCTACACTTAGCAGGTGTTTCCTCAATTCTAGGGGCCATCAACTTTATCACGACAATTATTAACATGAAACCCCCAGCCATTTCACAGTATCAGACCCCTCTGTTCGTCTGATCAGTATTAGTTACCGCCGTTCTTCTTCTCCTATCTCTCCCAGTCCTAGCTGCCGGGATTACAATGCTCCTCACAGATCGAAATCTCAACACCACCTTCTTTGATCCAGCAGGAGGAGGGGATCCAATCCTTTACCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plectorhinchus flavomaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • McKay, R.J. 1984 Haemulidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 2. FAO, Rome. pag. var. (Ref. 3412)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!