Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Found over muddy and sandy bottoms in coastal waters and in estuaries where the nursery and feeding grounds are located. Adults form schools. Feeding habits vary with ontogenic development and season; juveniles feed on benthic migratory crustaceans and sessile boring mollusks while adults are benthos-feeders and occasionally capture fish (Ref. 27). Undergoes seasonal migration. An important food fish which is usually marketed fresh and salted.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Greater Antilles and from Costa Rica to Argentina (Ref. 9626). Also reported in Nicaragua (Ref. 13613).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southwestern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 26 - 30; Analspines: 2; Analsoft rays: 7 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm SL (male/unsexed; (Ref. 27363)); max. reported age: 7 years (Ref. 27)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body silvery with a golden cast, back greyish, with distinct oblique dark streaks along scale rows extending to much below lateral line; spinous dorsal without small dark dots (Ref. 27363).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 60 m (Ref. 9626), usually 20 - 40 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 0.4 - 142
  Temperature range (°C): 7.904 - 27.555
  Nitrate (umol/L): 0.301 - 14.902
  Salinity (PPS): 31.427 - 37.096
  Oxygen (ml/l): 4.363 - 5.894
  Phosphate (umol/l): 0.095 - 1.676
  Silicate (umol/l): 1.250 - 11.021

Graphical representation

Depth range (m): 0.4 - 142

Temperature range (°C): 7.904 - 27.555

Nitrate (umol/L): 0.301 - 14.902

Salinity (PPS): 31.427 - 37.096

Oxygen (ml/l): 4.363 - 5.894

Phosphate (umol/l): 0.095 - 1.676

Silicate (umol/l): 1.250 - 11.021
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found over muddy and sandy bottoms in coastal waters and in estuaries where the nursery and feeding grounds are located. Adults form schools. Feeding habits vary with ontogenic development and season; juveniles feed on benthic migratory crustaceans and sessile boring mollusks while adults are benthos-feeders and occasionally capture fish (Ref. 27). Juveniles 10 cm TL were capable of consuming larger prey items than those in their stomachs, indicating that the maximum size of prey eaten was not constrained by mouth gape (Ref. 55704). Undergoes seasonal migration.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Micropogonias furnieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTGATTTTTGGTGCATGAGCCGGAATAATCGGCACAGCTTTAAGCCTACTGATTCGAGCCGAACTTAGCCAACCTGGCGCACTCCTCGGAGACGACCAAATCTATAACGTAATCGTTACGGCGCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCCATCATAATTGGAGGCTTCGGAAACTGACTTGTACCTCTAATGATTGGAGCCCCCGATATAGCATTCCCTCGGATGAATAATATGAGCTTCTGACTTCTCCCCCCTTCTTTCCTGCTACTCCTAACCTCCTCAGGAGTAGAGGCAGGTGCCGGAACAGGCTGAACAGTCTACCCTCCCCTCGCCGGAAATCTTGCACACGCAGGAGCCTCTGTCGACTTAGCCATTTTCTCCCTTCATCTCGCAGGTGTTTCATCAATTTTAGGGGCTATTAACTTTATTACAACAATTATTAACATGAAACCCCCAGCCATCTCCCAGTATCAGACACCTCTATTTGTATGAGCCGTTTTAATTACAGCTGTCCTACTTCTACTTTCACTTCCTGTCCTAGCCGCCGGCATTACAATGCTTCTAACAGACCGCAACCTAAATACAACCTTTTTTGACCCGGCAGGAGGGGGAGACCCAATTCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Micropogonias furnieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!