Articles on this page are available in 1 other language: Spanish (1) (learn more)
Overview
Comprehensive Description
Biology
Found over muddy and sandy bottoms in coastal waters and in estuaries where the nursery and feeding grounds are located. Adults form schools. Feeding habits vary with ontogenic development and season; juveniles feed on benthic migratory crustaceans and sessile boring mollusks while adults are benthos-feeders and occasionally capture fish (Ref. 27). Undergoes seasonal migration. An important food fish which is usually marketed fresh and salted.
-
Isaac, V.J. 1988 Synopsis of biological data on the whitemouth croaker, Micropogonias furnieri (Desmarest, 1823). FAO Fish. Synop. (150). (Ref. 27)
http://www.fishbase.org/references/FBRefSummary.php?id=27&speccode=7620
Trusted
Distribution
Western Atlantic: Greater Antilles and from Costa Rica to Argentina (Ref. 9626). Also reported in Nicaragua (Ref. 13613).
-
Chao, L.N. 1978 Sciaenidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. West Atlantic (Fishing Area 31). Volume 4. FAO, Rome. (Ref. 3702)
http://www.fishbase.org/references/FBRefSummary.php?id=3702&speccode=1162
Trusted
Gulf of Mexico
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 26 - 30; Analspines: 2; Analsoft rays: 7 - 9
-
Uyeno, T., K. Matsuura and E. Fujii (eds.) 1983 Fishes trawled off Suriname and French Guiana. Japan Marine Fishery Resource Research Center, Tokyo, Japan. 519 p. (Ref. 13608)
http://www.fishbase.org/references/FBRefSummary.php?id=13608&speccode=14336
Trusted
Size
Max. size
60.0 cm SL (male/unsexed; (Ref. 27363)); max. reported age: 7 years (Ref. 27)
-
Nakamura, I., T. Inada, M. Takeda and H. Hatanaka 1986 Important fishes trawled off Patagonia. Japan Marine Fishery Resource Research Center, Tokyo. 369 p. (Ref. 27363)
http://www.fishbase.org/references/FBRefSummary.php?id=27363&speccode=7119
-
Isaac, V.J. 1988 Synopsis of biological data on the whitemouth croaker, Micropogonias furnieri (Desmarest, 1823). FAO Fish. Synop. (150). (Ref. 27)
http://www.fishbase.org/references/FBRefSummary.php?id=27&speccode=7620
Trusted
Diagnostic Description
Body silvery with a golden cast, back greyish, with distinct oblique dark streaks along scale rows extending to much below lateral line; spinous dorsal without small dark dots (Ref. 27363).
-
Uyeno, T., K. Matsuura and E. Fujii (eds.) 1983 Fishes trawled off Suriname and French Guiana. Japan Marine Fishery Resource Research Center, Tokyo, Japan. 519 p. (Ref. 13608)
http://www.fishbase.org/references/FBRefSummary.php?id=13608&speccode=14336
Trusted
Ecology
Habitat
Environment
demersal; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 60 m (Ref. 9626), usually 20 - 40 m (Ref. 9626)
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
-
Cervigón, F. 1993 Los peces marinos de Venezuela. Volume 2. Fundación Científica Los Roques, Caracas,Venezuela. 497 p. (Ref. 9626)
http://www.fishbase.org/references/FBRefSummary.php?id=9626&speccode=171
Trusted
Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.
Environmental ranges
Depth range (m): 0.4 - 142
Temperature range (°C): 7.904 - 27.555
Nitrate (umol/L): 0.301 - 14.902
Salinity (PPS): 31.427 - 37.096
Oxygen (ml/l): 4.363 - 5.894
Phosphate (umol/l): 0.095 - 1.676
Silicate (umol/l): 1.250 - 11.021
Graphical representation
Depth range (m): 0.4 - 142
Temperature range (°C): 7.904 - 27.555
Nitrate (umol/L): 0.301 - 14.902
Salinity (PPS): 31.427 - 37.096
Oxygen (ml/l): 4.363 - 5.894
Phosphate (umol/l): 0.095 - 1.676
Silicate (umol/l): 1.250 - 11.021
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 29 samples.
Environmental ranges
Depth range (m): 0.4 - 142
Temperature range (°C): 7.904 - 27.555
Nitrate (umol/L): 0.301 - 14.902
Salinity (PPS): 31.427 - 37.096
Oxygen (ml/l): 4.363 - 5.894
Phosphate (umol/l): 0.095 - 1.676
Silicate (umol/l): 1.250 - 11.021
Graphical representation
Depth range (m): 0.4 - 142
Temperature range (°C): 7.904 - 27.555
Nitrate (umol/L): 0.301 - 14.902
Salinity (PPS): 31.427 - 37.096
Oxygen (ml/l): 4.363 - 5.894
Phosphate (umol/l): 0.095 - 1.676
Silicate (umol/l): 1.250 - 11.021
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Trophic Strategy
Found over muddy and sandy bottoms in coastal waters and in estuaries where the nursery and feeding grounds are located. Adults form schools. Feeding habits vary with ontogenic development and season; juveniles feed on benthic migratory crustaceans and sessile boring mollusks while adults are benthos-feeders and occasionally capture fish (Ref. 27). Juveniles 10 cm TL were capable of consuming larger prey items than those in their stomachs, indicating that the maximum size of prey eaten was not constrained by mouth gape (Ref. 55704). Undergoes seasonal migration.
-
Isaac, V.J. 1988 Synopsis of biological data on the whitemouth croaker, Micropogonias furnieri (Desmarest, 1823). FAO Fish. Synop. (150). (Ref. 27)
http://www.fishbase.org/references/FBRefSummary.php?id=27&speccode=7620
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Micropogonias furnieri
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTCTACCTGATTTTTGGTGCATGAGCCGGAATAATCGGCACAGCTTTAAGCCTACTGATTCGAGCCGAACTTAGCCAACCTGGCGCACTCCTCGGAGACGACCAAATCTATAACGTAATCGTTACGGCGCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCCATCATAATTGGAGGCTTCGGAAACTGACTTGTACCTCTAATGATTGGAGCCCCCGATATAGCATTCCCTCGGATGAATAATATGAGCTTCTGACTTCTCCCCCCTTCTTTCCTGCTACTCCTAACCTCCTCAGGAGTAGAGGCAGGTGCCGGAACAGGCTGAACAGTCTACCCTCCCCTCGCCGGAAATCTTGCACACGCAGGAGCCTCTGTCGACTTAGCCATTTTCTCCCTTCATCTCGCAGGTGTTTCATCAATTTTAGGGGCTATTAACTTTATTACAACAATTATTAACATGAAACCCCCAGCCATCTCCCAGTATCAGACACCTCTATTTGTATGAGCCGTTTTAATTACAGCTGTCCTACTTCTACTTTCACTTCCTGTCCTAGCCGCCGGCATTACAATGCTTCTAACAGACCGCAACCTAAATACAACCTTTTTTGACCCGGCAGGAGGGGGAGACCCAATTCTTTACCAACACTTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Micropogonias furnieri
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 36
Species With Barcodes: 1
Public Records: 8
Specimens with Barcodes: 36
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: highly commercial; price category: medium; price reliability: reliable: based on ex-vessel price for this species
-
Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
http://www.fishbase.org/references/FBRefSummary.php?id=4931&speccode=228
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


