Overview

Comprehensive Description

Biology

Inhabits reef areas, inshore bays and seagrass beds. Feeds mainly on zooplankton and small benthic animals, but may also feed on ectoparasites of other fishes (Ref. 9626). Spawn at midday throughout the year (Ref. 26938). A protogynous hermaphrodite (Ref. 55367). Generally of no interest to fisheries because of its small average size (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda, Florida (USA), southeastern Gulf of Mexico and throughout the Caribbean Sea to northern South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is common in the tropical waters of the western central Atlantic Ocean, and is found in Bermuda, Florida, the Gulf of Mexico, and the Caribbean Sea to Venezuela and Trinidad and Tobago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bluehead wrasses are common to the tropical waters of the western Atlantic Ocean. Their primary range includes the region around Bermuda and the waters south of Florida, reaching to northern South America and extending west into the southeast area of the Gulf of Mexico.

Biogeographic Regions: atlantic ocean

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: 42.4°N to Bermuda, Florida (USA), southeastern Gulf of Mexico and throughout the Caribbean Sea to northern South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 12 - 13; Analspines: 3; Analsoft rays: 10 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Bluehead wrasses have long, semi-cylindrical or cigar-shaped bodies. Their scales are round and flat. They have a pointed snout, and the mouth contains teeth. Their size and color, however, depend on whether they are terminal phase males, initial phase males, or females. Terminal phase (TP) males, also known as "supermales," have blue heads and green bodies. Three stripes (black, white, and black again) divide the colors of the head and body. Terminal phase males measure about 70 to 80 mm in length while initial phase males are approximately 60 mm. Initial phase (IP) females and males are colored in two different ways. One type has a yellow upper half of the body followed by a slight green/black area and then a white lower half. Females and initial phase males are also known to be white both above and below the dark area. This type of coloration is found in fish that primarily inhabit inshore regions. A dark spot is found on the anterior dorsal fin of both types of females and initial phase males. It should also be noted that females and initial phase males have the ability to change into terminal phase males and this switch includes a change of size and coloration. In addition, once there is a transformation from female or initial phase male to terminal phase male, the change is permanent.

Range length: 80 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 26340)); max. reported age: 3 years (Ref. 3420)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body elongate; 3 primary color phases, the smallest with a black mid-lateral stripe which continues as pale red blotches on head; back above stripe yellow on reef fish and whitish on fish from inshore non-reef areas, and body below white. The largest phase, has a bright blue head and a green body with two broad vertical black bars anteriorly which are separated by a light blue interspace; this phase is always male. The small yellow phase with the black stripe may be either male or female (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Julis nitidissima
Catalog Number: USNM 21960
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Bermuda, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 40 m (Ref. 9710), usually 3 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is one of the best-studied protogynous hermaphrodites (Warner and Swearer 1991, Schärer and Vizoso 2003, Munday et al. 2006). It occurs in tropical waters and associates with coral reefs to depths of at least 40 m, and is also known to inhabit inshore bays and seagrass beds. Tagging studies showed that adults do not leave the reef upon which they have settled (Warner and Hoffman 1980).

Individuals feed primarily on zooplankton and small benthic crustaceans (Warner and Hoffman 1980), including echinoderms (sea stars, brittle stars), molluscs and polychaetes, in addition, diet consists of ectoparasites found on other fishes (Deloach 1999).

This species occurs in two major colour phases, initial phase individuals can be either males or females. The common terminal phase individuals are males and tend to be the largest individuals in any local population (Warner and Robertson 1978). Large females are able to change sex into secondary males (Warner et al. 1975). Sex change and the transition to terminal phase coloration are reported to be controlled by local social conditions (Warner et al. 1975).

Spawning occurs on a daily basis throughout the year (Warner et al. 1975, Warner and Robertson 1978, Warner and Hoffman 1980, Fitch and Shapiro 1990), for about an hour in mid afternoon. Fertilization is external and there is no parental care of the pelagic zygotes (Warner and Hoffman 1980, Warner 1984). Randall and Randall (1963), however, noted that reproduction seemed to occur mostly within a period of a few days during the full moon and to a lesser extent, new moon. During the mating period, the majority of males are located at the down-current end of the reef, where they attempt to mate with the arriving females. T. bifasciatum is noted as resident spawning aggregation which is aggregated by locally abundant populations from the same reef (Domeier and Colin 1997). Seasonal recruitment was found in Barbados, West Indies and spawning was found to occur primarily between January and August (Herbing and Hunte 1991).

The largest terminal phase males aggressively defend breeding sites and therefore gain exclusive access to females visiting the site, conversely, initial phase females or males have no territorial defense and are much less aggressive (Warner 1984). The mean home range of adults is approximately eight m2 at Tague Bay, St. Croix, U.S. Virgin Island, while for juveniles it was less than two m2 (Jones 2005). The home range area was positively correlated with the fish total length

It has been found that the predators of this species include Aulostomus maculates, Epinephelus guttatus, Myceteropera venenosa and Rypticus saponaceus. Length at sex change has been reported at 8.3 cm TL (Allsop and West 2003) and individual fish mature at 3.5 cm SL, size approximately 30 % of the maximum size (Warner 1998). Evidence showed that the final body sizes might have a strong influence on maturity sizes (Robertson 1972, Warner and Swearer 1991). Minimum population doubling time is less than 15 months (Froese and Pauly 2008) and maximum lifespan is estimated to be three years for individuals reaching the terminal phase (Warner 1998).

Eggs hatch at 1.4 mm (Cato and Brown 2003). Larvae are approximately 12 mm in length and the pelagic larval duration has been found to be 38 to 54 days (Philibotte 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bluehead wrasses live in tropical waters, often around coral reefs, as well as offshore reefs. They are also known to inhabit other areas such as inshore bays and seagrass beds. Herds of bluehead wrasse that consist of initial males and females feed in reefs, rubble beds, and gorgonian fields. Bluehead wrasses inhabit areas that vary in size, the size of the area usually reflecting population size, with about 200 fish living on a small reef and up to 10,000 fish on some of the larger reefs. Tagging studies have shown that blueheads do not move from reef to reef.

Range depth: 1 to 25 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

  • Warner, R. R., S. E. Swearer. 1991. Social control of sex change in the Blueheaded Wrasse, Thalassoma bifasciatum (Pisces: Labridae). Biological Bulletin, 181: 199-204.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits reef areas, inshore bays and seagrass beds.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 160 specimens in 1 taxon.
Water temperature and chemistry ranges based on 130 samples.

Environmental ranges
  Depth range (m): 0.25 - 150
  Temperature range (°C): 7.115 - 28.503
  Nitrate (umol/L): 0.161 - 10.594
  Salinity (PPS): 33.480 - 36.594
  Oxygen (ml/l): 3.530 - 6.022
  Phosphate (umol/l): 0.046 - 0.811
  Silicate (umol/l): 0.866 - 5.686

Graphical representation

Depth range (m): 0.25 - 150

Temperature range (°C): 7.115 - 28.503

Nitrate (umol/L): 0.161 - 10.594

Salinity (PPS): 33.480 - 36.594

Oxygen (ml/l): 3.530 - 6.022

Phosphate (umol/l): 0.046 - 0.811

Silicate (umol/l): 0.866 - 5.686
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits reef areas, inshore bays and seagrass beds. Feeds mainly on zooplankton and small benthic animals, but may also feed on ectoparasites of other fishes (Ref. 9626). Feeds on planktonic and benthic invertebrates (Ref. 33). Planktivore (Ref. 57616)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

These fish forage for zooplankton, worms, mollusks, echinoderms, shrimp, and other small crustaceans at depths of 3 to 80 feet. Initial phase bluehead wrasses primarily eat zooplankton found in the water current, but herds of females and initial phase males also hunt daily during daylight hours. By hunting in packs, IP bluehead wrasses steal eggs from egg-laying fishes including redlip blennies (Ophioblennius atlanticus), bicolor damselfish (Stegastes partitus), and sergeant majors (Abudefduf vaigiensis). A herd of bluehead wrasses are able to interrupt the defenses of the nest's guardian and steal eggs for several minutes before they are driven away.

Bluehead wrasse diet also consists of parasites found on other fish. Although initial phase bluehead wrasse are one of the primary cleaners of the Caribbean, they only account for 10% of the cleaning activity on the reefs because they are also frequently preyed upon by the fish they clean. Nonetheless, bluehead wrasses remove parasites and reduce disease among fish that stop at cleaning stations. By cleaning wounds of injured fish, it is speculated that they speed up the healing process. Terminal phase males rarely function as cleaners because of their well-developed teeth which enable them to eat hard-shelled invertebrates.

Animal Foods: fish; eggs; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore , Eats eggs, Eats non-insect arthropods, Molluscivore , Vermivore, Scavenger ); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Bluehead wrasse are described as "one of the most successful cleaner fish" in the tropical Atlantic. They feed on the parasites of other fish that come to wrasses to be cleaned. Initial phase bluehead wrasse are classified as primary cleaners and they account for ten percent of the cleaning activities that take place within Caribbean reefs. Initial phase bluehead wrasse have also been spotted cleaning parasites from the mouths of other fish as well as purifying the wounds of injured fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

A list of the known predators of Thalassoma bifasciatum is shown below.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Prior to mating, it has been observed that terminal phase males seem to communicate with females in an attempt to attract them. Terminal phase males wait in their spawning sites for females to arrive. The terminal phase males then perform signal jumps, which involve quick, vertical dashes repeated over and over. The signal jumps are a way for terminal phase males to communicate to females that they are present and ready to mate and also to show that their site is free from predators. It was also observed that a terminal phase male sometimes extends this communication, which takes place prior to mating, by descending to the female and making contact with her dorsal area.

Females, on the other hand, are not known to exhibit behaviors like the terminal phase males. A female communicates to the male that she is ready to mate by turning her head upwards and then dashing towards the surface of the water.

Terminal phase males exhibit aggressive behavior to other fish, especially just before mating. This form of communication is demonstrated when they chase other organisms from the site they pick to spawn. Initial phase males and females are not typically aggressive unless they are developing into terminal phase males. This characteristic of aggression helps distinguish social rank among the terminal phase males, initial phase males, and initial phase females with the terminal phase males being the only group to behave aggressively towards other fish.

Body color seems to be important in communication, as color communicates social status and mood during aggressive encounters (see Behavior).

Communication Channels: visual ; tactile

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

A diandric species (Ref. 55367). Sex reversal is completed in more than 3-4 weeks (Ref. 34185, 34257). Length at sex change = 8.3 cm TL, forms leks during breeding (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Bluehead wrasses begin in a larval state. Bluehead larva are 12 mm in length and have one large black spot at the anterior end of the dorsal fin as well as a series of small black dots along the distal edges of the dorsal, anal, and caudal fins. There are no erythrophores behind the head. The larvae spend 6 to 8 weeks in the open sea, then bury themselves in the sand as they metamorphose into juveniles. Individual fish mature at 35 mm standard length.

As the juveniles age, they turn yellow and collect in groups either in select areas of the reef or seagrass beds. The fish stay there until they completely develop and reach sexual maturity. Those that survive this stage eventually develop a dark stripe along their body. They will then become a part of a nearby population and are considered to be in the initial phase. Bluehead wrasses tend to stay where they have settled.

Development - Life Cycle: metamorphosis

  • Natural Museum of Natural History: Department of Systematic Biology- Division of Fishes. 2002. "Larval Fish: Labroidei" (On-line ). Larval Fishes from Carrie Bow Cay, Belize. Accessed 03/22/02 at http://www.nmnh.si.edu/vert/larval/labroi.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum lifespan is estimated to be 3 years for individuals reaching the terminal phase.

Average lifespan

Status: captivity:
3 years.

  • Warner, R. R. 1998. The role of extreme iteroparity and risk avoidance in the evolution of mating systems. Journal of Fish Biology, 53: 82-93.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

This fish species exhibits protogyny (females are capable of becoming males). Females, IP males, and TP males, however, are capable of reproducing. The density of TP males in the spawning sites is associated with the size of the reef. On small reefs (under 600 sq. m) with fewer than 200 bluehead wrasses, there are very few IP males and TP males defend territories of a small number of females. On large reefs (over 1000 sq. m) with over 400 bluehead wrasses, IP males may make up 50% of the population. Here, group-spawning is much more common particularly in downcurrent areas. In areas of high population density, TP males tend to be found primarily in upcurrent sites.

Mating System: polygynandrous (promiscuous)

Terminal phase males aggressively defend breeding sites and therefore gain exclusive access to females visiting the site. They may mate with more than 100 females per day, but the mean range is from 30 to 50.

Initial phase males exhibit no breeding site defense, are much less aggessive than TP males and often sneak-mate with a TP male/ female pair. The IP males mate in large aggregations where the operational sex-ratio can exceed 50 IP males per female.

Initial phase females have no breeding site defense, show little aggression toward other IP fish and visit spawning sites containing either single TP males or IP male aggregations.

Transitional sex changers aggressively defend their breeding sites from the first day with an increase over the next several days. They display a full repertoire of mating behavior including spawning, but do not contribute gametes until the sex change is complete, which happens within 7 to 10 days.

Breeding interval: Males breed daily, females breed every 2 to 3 days.

Key Reproductive Features: iteroparous ; year-round breeding ; sequential hermaphrodite (Protogynous ); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Bluehead wrasses provide no parental care for their offspring.

Parental Investment: no parental involvement

  • Warner, R. R., S. E. Swearer. 1991. Social control of sex change in the Blueheaded Wrasse, Thalassoma bifasciatum (Pisces: Labridae). Biological Bulletin, 181: 199-204.
  • Warner, R. R. 1984. Mating behavior and hermaphroditism in coral reef fishes. American Scientist, 72: 128-136.
  • Ford, D., J. Miranda, J. Godwin, K. Semsar, M. Grober. 1999. Sex Change in the Bluehead Wrasse: Temporal Concordance of Changes in Brain and Behavior. Arizona State University Sixth Annual Undergraduate Research Poster Symposium. Accessed 03/22/03 at http://lsvl.la.asu.edu/ubep99/abstracts/abst62/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma bifasciatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTGTGTTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATCCGAGCAGAGTTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATTTATAACGTTATCGTTACAGCCCACGCATTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTAATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGGATGAACAATATAAGCTTCTGACTTCTTCCACCCTCATTCCTTCTTCTTCTCGCCTCCTCTGGCGTTGAGGCAGGGGCCGGAACTGGTTGGACAGTCTACCCACCCCTAGCAGGGAACCTTGCCCATGCTGGTGCATCCGTTGACCTTACTATTTTTTCACTTCACTTGGCAGGGATTTCATCAATTCTAGGTGCAATCAACTTCATCACAACCATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACGCCTCTTTTCGTATGGGCTGTTCTCATTACGGCAGTCCTTCTCCTCCTCTCGCTCCCAGTCCTTGCCGCTGGTATTACAATGCTCCTAACAGACCGAAATCTTAACACCACYTTCTTCGACCCTGCTGGAGGGGGGGACCCAATTCTTTACCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma bifasciatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Specimens with Barcodes: 62
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S., Liu, M. & Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the northwestern Atlantic and is common in many parts of its range. Although it is collected for the aquarium trade, and is closely associated with reef habitat, these are not currently considered to be a threat to this species global population. It listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bluehead wrasses are not found on any of the conservation lists.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout the northwest Atlantic (Warner 1984) and Caribbean coral reefs (Herbing and Hunte 1991, Warner and Schultz 1992). It is one of the most abundant species throughout the West Indies (Florida Museum of Natural History-Ichthyology Department).

Through a series of underwater visual surveys, 1,334 individuals and 2,335 individuals were observed in La Parguera Region, Puerto Rico and Rincón Region, Puerto Rico, respectively, and this species has been observed to be one of the most abundant reef fish species in both regions (Richard et al. 2006). In the Virgin Islands (USA), fish density has been reported at 3.4 individuals m2 and over 10,000 individuals have been observed at any one time at the aggregation (Warner 1995). It is one of the most frequently sighted species in Bonaire reefs, Netherlands Antilles (Pattengill-Semmens undated), and 5,087 individuals were observed in Barbados Marine Reserve, Barbados between August and December, in 1992 (Rakitin and Kramer 1996).

In addition, it is known that population varies according to the size of reefs, with about 200 individuals living on a small reef (under 600 m2) and up to 10,000 individuals on some of the larger reefs (over 1,000 m2) (Warner 1984).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is closely associated with coral reefs and shows high site fidelity. Adults remain on their home reefs, with no emigration or immigration after settlement (Warner and Hoffman 1980).

Habitat destruction may pose a local threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.

This species is found in marine reserves in the Florida Keys National Marine Sanctuary, USA (Grorud-Colvert 2006), Hol Chan Marine Reserve, Belize (National Parks of Belize), Barbados Marine Reserve, Barbados (Cheney and Côté 2003), Barbados Marine Park (Rakitin and Kramer 1996) and Bonaire Marine Park, Bonaire (Pattengill-Semmens undated). It is worth noting that Barbados Marine Park does not imply as a no-take zone, baited fishing and trawling are still allowed within the areas and currently two non-fishing zones are being proposed (STINAPA Bonaire 2007).

While many marine parks have already been introduced in areas within the geographic range of T. bifasciatum, it is worth noting that the degree of protection within marine reserve varies according to the effectiveness of management. Currently, there is little information on the effectiveness of those marine parks, therefore, more information is necessary to establish its conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There was no information found about any negative impacts Thalassoma bifasciatum may have on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These fish have no economic value as a food source, because of their small size, but the brilliant colors of the bluehead wrasse make these fish popular for use in the aquarium trade. Their coloration and daily spawning make them a favorite among divers visiting the Caribbean.

Bluehead wrasses have been studied for over 70 years. This species is a popular research subject primarily because of its ability to change sex.

Positive Impacts: pet trade ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma bifasciatum

Blue-headed wrasse

Thalassoma bifasciatum is a species of saltwater fish in the wrasse family (family Labridae) of order Perciformes native to the coral reefs of the Caribbean Sea. Like its relative T. amblycephalum it is commonly called "blue-headed wrasse", "blunt-headed wrasse" or "bluehead". Blueheads are small (less than 110 mm standard length) and rarely live longer than 2 years. They form large schools over the reef and feed primarily on planktonic copepods as well as small benthic crustaceans.

Contents

Life cycle

Like many other wrasse species, the bluehead is a protogynous sequential hermaphrodite: individuals may begin life either as males or females, but females can change sex later in life and function as males. Young/small females and males are yellow and white in color, often with black lateral stripes and occasionally dark vertical bars. This coloration is known as the "Initial Phase". These individuals can rapidly alter the presence or intensity of their yellow color, stripes, and bars, and these color changes appear to correspond to behavioral changes. Large females and some males can permanently change coloration and/or sex and enter the "Terminal Phase" coloration, which has a blue head, black and white bars behind the head, and a green body. It is this color phase that gives the species its name.

The Initial Phase males ('IP males') have comparatively larger testes than the larger, terminal phase males. This enables the initial phase males to produce lots of sperm for the snatched opportunities they must take when trying to fertilize the eggs of the females in the guarded harem.[1] Initial phase males also achieve fertilizations through participating in group spawns. These groups consist of 20–50 or more IP males that congregate at specific sites during the daily spawning period on medium and larger sized reefs. Females visit these groups to spawn and release eggs in a 'spawning rush'. IP males attempt to position themselves next to a female when she releases her eggs as this maximizes their probability of fertilizing these eggs. Releasing large numbers of sperm also increases this probability and this is thought to also help explain the large testis size observed in IP males. This type of mating competition is referred to as 'sperm competition' and is seen in many species.

Modeling sex change

The bluehead wrasse and its congener, the Hawaiian saddleback wrasse (Thalassoma duperrey), have become important models for understanding the physiological and neurobiological bases of sex change. Sex change can be induced socially in both species by making large females the largest members of social groups. Sex change in experimental pens by saddleback wrasses involves complete gonadal transformation with associated decreases in a key steroid hormones (estradiol and 11-ketotestosterone) and steroid hormone synthesizing enzymes in the gonads. Sex changing saddleback wrasses also show substantial changes in brain levels of the monoamine neurotransmitters serotonin, dopamine, and norepinephrine.

Sex change has been studied in bluehead wrasses primarily using field manipulations, where it can be induced in large females by removing dominant TP males from small reefs. Gonadotropin-releasing hormone (GnRH) neurons differ across sexual phenotypes in the hypothalamus of bluehead wrasses and also with androgen implants that induce sex change. Behavioral sex change is very rapid in bluehead wrasses under field conditions, with male-typical behaviors being observed within minutes to hours after dominant terminal phase males are removed. Interestingly, behavioral sex change occurs even in females whose gonads (ovaries) have been surgically removed prior to becoming socially dominant. Behavioral sex change is associated with increases in expression of a neuropeptide hormone termed arginine vasotocin or AVT and these increases occur regardless of whether sex changing females have gonads or not. Injections of AVT can induce sexual and aggressive behaviors in terminal phase male bluehead wrasses while injections of fluoxetine (tradename: Prozac) can reduce aggressive behaviors by terminal phase males.

Mating Systems

Large males that are in terminal color phase will defend breeding sites where females migrate to on a daily basis. A study was done to estimate the relative roles of each sex in choosing the location of such sites. All terminal-phase males or all females were replaced in local isolated populations, and the resulting site use was monitored. After males were replaced, the mating system was not affected. On the other hand, after the females were replaced, half of the old sites were lost and the same number of new sites came into use, and continued to be occupied for over a year after these manipulations. This occurred although large males originally continued to defend and display at the original sites. Therefore, this shows the importance of female choice in the feeding system of the blue-headed wrasse, and that males will respond to the females’ site preferences. [2]

Most of the literature on mating systems of the blue-headed wrasse was described in small patches of concentrated reef habitats. In a large, linear barrier reef in St. Croix, U.S. Virgin Islands, very large aggregations of group-matings form daily in a single area near the foreside of the reef. Tagging studies have shown that fish are generally faithful to particular feeding schools that are assorted throughout the forereef, and that they tend to migrate to spawning grounds over 1.5 kilometers away. There is no mating that appears to happen in other upcurrent areas of the forereef. Despite large differences in the times that are spent on the migration, there are no significant differences in the fecundity or frequency of spawning among females that live at different distances from the mating aggregation. The higher growth rate corresponded to a higher general feeding rate in the location, suggesting that food intake may outweigh the costs of the long migration. [3]

References

  1. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
  2. ^ Warner, R. R. (1995). Large mating aggregations and daily long-distance spawning migrations in the bluehead wrasse, Thalassoma bifasciatum. Environmental Biology of Fishes.
  3. ^ Warner, R. R. (1990). Male versus female influences on mating-site determination in a coral reef fish. Animal Behavior.
  • "Thalassoma bifasciatum". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=170568. Retrieved 30 January 2006.
  • Froese, Rainer, and Daniel Pauly, eds. (2005). "Thalassoma bifasciatum" in FishBase. 10 2005 version.
  • Godwin J., Neuroendocrinology of sexual plasticity in teleost fishes, Frontiers in Neuroendocrinology, 2010. 31(2): p. 203–216.
  • Godwin, J., D. Crews, and R.R. Warner, Behavioural sex change in the absence of gonads in a coral reef fish. Proceedings of the Royal Society of London B-Biological Sciiences, 1996. 263: p. 1683–1688.
  • Godwin, J., R. Sawby, R.R. Warner, D. Crews, and M.S. Grober, Hypothalamic arginine vasotocin mRNA abundance variation across sexes and with sex change in a coral reef fish. Brain Behavior and Evolution, 2000. 55: p. 77–84.
  • Grober, M.S. and A.H. Bass, Neuronal correlates of sex/role change in labrid fishes: LHRH-like immunoreactivity. Brain Behavior and Evolution, 1991. 38: p. 302–312.
  • Grober, M.S., I.M.D. Jackson, and A.H. Bass, Gonadal steroids affect LHRH preoptic cell number in sex/role changing fish. Journal of Neurobiology, 1991. 22: p. 734–741.
  • Hourigan, T.F., M. Nakamura, Y. Nagahama, K. Yamauchi, and E.G. Grau, Histology, ultrastructure, and in vitro steroidogenesis of the testes of two male phenotypes of the protogynous fish, Thalassoma duperrey (Labridae). General and Comparative Endocrinology, 1991. 83: p. 193–217.
  • Munday, P.L., P.M. Buston, and R.R. Warner, Diversity and flexibility of sex-change strategies in animals. Trends in Ecology and Evolution, 2006. 21(1): p. 89–95.
  • Nakamura, M., T.F. Hourigan, K. Yamauchi, Y. Nagahama, and E.G. Grau, Histological and ultrastructural evidence for the role of gonadal steroid hormones in sex change in the protogynous wrasse Thalassoma duperrey. Environmental Biology of Fishes, 1989. 24: p. 117–136.
  • Perreault, H.A., K. Semsar, and J. Godwin, Fluoxetine treatment decreases territorial aggression in a coral reef fish. Physiology & Behavior, 2003. 79: p. 719–724.
  • Semsar, K., F.L.M. Kandel, and J. Godwin, Manipulations of the AVT system shift social status and related courtship and aggressive behavior in the bluehead wrasse. Hormones and Behavior, 2001. 40: p. 21–31.
  • Semsar, K. and J. Godwin, Social influences on the arginine vasotocin system are independent of gonads in a sex-changing fish. Journal of Neurosciience, 2003. 23: p. 4386–4393.
  • Semsar, K., H.A. Perreault, and J. Godwin, Fluoxetine-treated male wrasses exhibit low AVT expression. Brain Research, 2004. 1029: p. 141–147.
  • Warner, R.R., Large mating aggregation and daily long-distance spawning migrations in the bluehead wrasse, Thalassoma bifasciatum. Environmental Biology of Fishes, 1995. 44: p. 337–345.
  • Warner, R.R. and L.M. Dill, Courtship displays and coloration as indicators of safety rather than of male quality: the safety assurance hypothesis. Behavioral Ecology, 2000. 11(4): p. 444–451.
  • Warner, R.R. and Robertson, D.R. 1978. Sexual patterns of the labroid fishes of the western Caribbean: 1. The wrasses (Labridae). Smithsonian Contributions to Zoology, 254, 1–27.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!