Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Surgeonfishes (family Acanthuridae) are strikingly colored and patterned reef fishes. They are daytime grazers that travel in large schools, constantly moving as they snap up bits of algae. Some species have a moveable scalpel-like spine (used for defense) that folds forward into a groove on either side of the base of the tail, accounting for both the scientific and common names for the family.

The Yellowfin Surgeonfish (Acanthurus xanthopterus) is a large surgeonfish (up to around 60 cm) with a distinctive yellow blotch behind and in front of the eye, pectoral fins with yellow on at least the outer third, a bluish tail (often with a whitish band at the base), dorsal and anal fins with 4 to 5 dull yellow stripes alternating with blue (the base with a pale blue band), and a black spine sheath. The caudal (tail) spine is relatively small. Adults usually occur in small to large groups and are found especially around deep offshore reefs, generally below around 20 m down to a maximum depth of about 90 m. Juveniles live in shallow protected areas. Yellowfin Surgeonfishes graze the surface of sand and rubble for soft algae. These common fish are found throughout the Indo-Pacific and tropical eastern Pacific south to KwaZulu-Natal (eastern coast of South Africa).

(Randall et al. 1997; Smith 1997; King anfd Fraser 2002)

  • King, D. and V. Fraser. 2002. More Reef Fishes & Nudibranchs: East and South Coast of Southern Africa. Struik, Cape Town, South Africa.
  • Randall, J.E., G.R. Allen, and R.C. Steene. 1997. Fishes of the Grear Barrier Reef and Coral Sea, 2nd ed. University of Hawaii Press, Honolulu.
  • Smith, C.L. 1997. National Audubon Society Field Guide to Tropical Marine Fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

  Common names: surgeonfish (English), cirujano (Espanol), navajón (Espanol)
 
Acanthurus xanthopterus Valenciennes in Cuvier & Valenciennes, 1835


Yellowfin surgeonfish,     Purple surgeonfish


Body an elongate oval; head profile steep; eye high on the head; mouth small, protrusible, low on head; teeth on jaws fixed, with flattened, notched tips, 8-28 on each jaw; gill rakers 16-24; dorsal rays IX, 25-27; anal rays III, 23-25; pectoral rays 16-17; pelvic fin I, 5; a large depressible spine fits into a groove on the side of the base of the tail; tail fin strongly concave;  scales very small, rough; lateral line complete.


Purplish grey to brown, outer third of pectoral fin yellowish; yellow area around and in front of eye; base of tail fin often with white bar; can quickly assume a very pale grey coloration with numerous dark wavy lines on the side.


Size: 70 cm.

Habitat: generally seen in sandy areas.

Depth: 1-100 m.

Widespread in the tropical Indo-Pacific from East Africa to the Americas; in the eastern Pacific it ranges from the mouth of the Gulf of California to Ecuador and all the oceanic islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Live in various reef habitats, sand slopes and lagoons (Ref. 48637). Juveniles inhabit shallow, protected, turbid inshore waters while adults prefer deeper areas of protected bays and lagoons. Also in outer reef areas (Ref. 1602). Benthopelagic (Ref. 58302). Schooling species, feed on diatoms, detritus film of sand, filamentous algae, hydroids, and pieces of fish (Ref. 1602, 48637). Probably the only surgeonfish that readily takes bait (Ref. 12484).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Acanthurus xanthopterus is widespread in the tropical Indo-Pacific from eastern Africa to the Americas. In the Indo-Pacific, it occurs from eastern Africa to the Hawaiian islands and French Polynesia, northwards to southern Japan, and south to the Great Barrier Reef and New Caledonia. In the eastern Pacific, it ranges from the mouth of the Gulf of California to Ecuador, including all the oceanic islands, but excluding the Central American Gap (coastal El Salvador, Guatemala). One record from Halaniyat Islands, southern Oman is possibly a vagrant (J. McIlwain unpub. data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Panama, north to southern Japan, Ogasawara Islands and Hawaiian Islands, south to Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian Islands and French Polynesia, north to southern Japan, south to the Great Barrier Reef and New Caledonia. Eastern Pacific: lower Gulf of California and Clipperton Island to Panama and the Galapagos Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 100 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 25 - 27; Analspines: 3; Analsoft rays: 23 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 70.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 4795))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Juveniles inhabit shallow, protected, turbid inshore waters while adults prefer deeper areas of protected bays and lagoons. This schooling species feeds on diatoms, detritus film of sand, filamentous algae, hydroids, and pieces of fish (Ref. 1602). Generally at depths greater than 20 m (Ref. 2334). Fairly rare around Tahiti due to overfishing. Caught by handline and spearfishing.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body purplish gray when alive; grayish brown when preserved; a region of dull yellow in front of eye, a lesser extension posterior to lower part of eye; outer 1/3 of pectoral fin yellow, extreme distal part hyaline; dorsal and anal fins yellowish grey basally, dull yellow distally; caudal fin base whitish; caudal fin purplish. Anterior gill rakers 16-24, posterior 17-22. Caudal spine small.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Hepatus aquilinus
Catalog Number: USNM 51759
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: American Samoa: Tutuila Island, Pago Pago, Tutuila, American Samoa, Samoa Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This reef-associated species lives in various reef habitats, sand slopes and lagoons (Kuiter and Tonozuka 2001). It is more common in lagoons and bays than exposed outer reef areas; usually found at depths greater than 10 to 15 m; reported to 90 m (Randall 2001b). Consistently feeds on the faeces of other pelagic species especially Carangids (J.H. Choat, pers comm. 2010). In Gulf of Chiriqui, Panama, this species can be found over most kinds of substrata except for deep zones of middle size rocks and sand (Dominici-Arosemena and Wolff 2006). According to Rubio (1986), at Gorgona Island, Colombia, this fish (cited as A. glaucopareius) is abundant on rocky and sandy substrata, while it is also frequently found on coralline substrata.

Juveniles recruit to shallow, protected, turbid inshore waters, while adults are usually found in outer reef areas (J.H. Choat pers. comm. 2010). It is also found on outer reef areas (Myers 1991, Kuiter and Tonozuka 2001). It feeds on sediment and detritus (Choat et al. 2004). It is classified as a grazer/detritivore (Choat and Bellwood pers. obs. in Green and Bellwood 2009). It is more inclined than other species of Acanthurus to stray from the shelter of coral reefs or rocky outcrops. It may occur as solitary individuals or in small aggregations (Randall 2001b). Maximum age is 34 years (Choat and Robertson 2002a).


Reproduction

The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). This species forms spawning aggregations in Palau from January-May during the new and full moon (Johannes,1981). It was also reported to form spawning aggregations on the Great Barrier Reef (Squire and Samoilys unpub.).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 100m.
From 1 to 100 meters.

Habitat: reef-associated. Juveniles inhabit shallow, protected, turbid inshore waters while adults prefer deeper areas of protected bays and lagoons. Also in outer reef areas. This schooling species feeds on diatoms, detritus film of sand, filamentous algae, hydroids, and pieces of fish (Ref. 1602).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 100 m (Ref. 9267), usually 5 - 90 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0.25 - 36
  Temperature range (°C): 25.689 - 28.941
  Nitrate (umol/L): 0.047 - 2.498
  Salinity (PPS): 32.938 - 36.148
  Oxygen (ml/l): 4.503 - 4.812
  Phosphate (umol/l): 0.092 - 0.409
  Silicate (umol/l): 0.819 - 4.752

Graphical representation

Depth range (m): 0.25 - 36

Temperature range (°C): 25.689 - 28.941

Nitrate (umol/L): 0.047 - 2.498

Salinity (PPS): 32.938 - 36.148

Oxygen (ml/l): 4.503 - 4.812

Phosphate (umol/l): 0.092 - 0.409

Silicate (umol/l): 0.819 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Commonly occurs in protected deeper waters of bays & lagoons. Lives in various reef habitats, sand slopes (Ref. 48637). Juveniles inhabit shallow, protected, turbid inshore waters while adults prefer deeper areas of protected bays and lagoons, and outer reef areas. This schooling species feeds on diatoms, detritus film of sand, filamentous algae, hydroids, pieces of fish (Ref. 1602, 48637) and fleshy macroalgae (Ref. 5543). Probably the only surgeonfish that readily takes bait (Ref. 12484). Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Herbivore

Diet: benthic microalgae, detritus, soft corals/hydroids
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Acanthurus xanthopterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Acanthurus xanthopterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTGAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCTTAGGGGATGACCAAATTTATAATGTAATTGTTACAGCACACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAACTGATTAATTCCACTAATGATTGGAGCCCCTGATATAGCATTCCCACGAATGAACAATATGAGTTTTTGACTACTACCCCCATCTTTCCTACTCTTACTTGCATCCTCTGCAGTAGAATCCGGTGCTGGTACTGGGTGAACAGTCTACCCTCCTCTAGCTGGTAACCTTGCACATGCAGGAGCATCCGTAGACCTAACTATTTTCTCCCTTCACCTCGCAGGAATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATAAAACCTCCTGCTACTTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTATTAATTACTGCCGTCTTACTGCTTCTTTCACTTCCTGTTCTTGCTGCTGGTATTACAATATTACTCACAGACCGAAACCTAAATACCACCTTCTTTGACCCGGCAGGCGGAGGAGATCCCATCCTATATCAACATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Rocha, L.A., Nanola, C., Russell, B. & Stockwell, B.

Reviewer/s
McClenachan, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus xanthopterus is widespread in the Indo-Pacific and is common in parts of its range. It is a targeted food fish in parts of its distribution. There are no signs of global population declines through harvesting. Its distribution overlaps with a number of marine protected areas. It is therefore listed as Least Concern. We recommend monitoring of the harvest levels and population trends of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Acanthurus xanthopterus is common in outer reef slopes. It was recorded as occasional in terms of relative abundance in Milne Bay Province and northern Bismarck Sea, Papua New Guinea. It is usually on sandy slopes adjacent to reefs (Allen 2003, 2009). It is moderately common in Raja Ampat, Indonesia (Allen 2003b). It is uncommon in the American Samoa National Park (National Park of Samoa Checklist of Fishes, accessed 21 April 2010). It is rare in Palawan, Philippines; only a few sub-adults were observed (Werner and Allen 2000, Palawan Council for Sustainable Development unpub. data). It is common elsewhere in the Philippines (B. Stockwell pers. comm. 2010).

In American Samoa, landings of acanthurids totaled 13,431 lbs. or 9% of the total catch. This species and Alogo (Acanthurus lineatus), comprised 82% of the total acanthurid catch. A. xanthopterus were caught by hook and line methods and 79% by weight were caught in the Fagatogo area. Most of those were caught by hand line and rod and reel anglers fishing from small canoes. 5,996 lbs were landed in the study area from July 1990 through June 1991 (Ponwith 1991).

This species comprises 9.5% of the acanthurid fishery in Pohnpei (Rhodes et al. 2008), 5% of the fishery in Guam and 8% in Saipan (Guam Division of Aquatic and Wildlife Resources unpub. data, P. Houk unpub. data). This species is collected as an aquarium fish in West Hawaii. The total number of individuals caught from FY 2005-2009 was 124 with a total value of $321 (Walsh et al. 2010).

In Kenya, landings during 1978-2001 for families that are less important in commercial catches (e.g., scarinae and Acanthuridae) showed rising catches (1978-1984) followed by a general decline during the 1990s (Kaunda-Arara et al. 2003).

In the tropical eastern Pacific, this species can be locally common. According to Robertson and Allen (1996), this fish has a doubtful population status in Clipperton Atoll. It was studied in the Galapagos archipelago, with an overall mean density of 0.06 ind/500 m2 (Edgar et al. 2004). Some surveys conducted in northern part of Costa Rica did not observe this fish (Dominici-Arosemena et al. 2005, Figueroa 2001). However, it was observed three times in one coral zone north of Costa Rica (Espinoza and Salas 2005). It has been regularly recorded in southern Costa Rica, including Cano Island and Cocos Island.

According to Aburto-Oropeza and Balart (2001), A. xanthopterus is a rare species at Los Islotes, Gulf of California, having an occurrence frequency below 10%. A survey conducted at Gorgona Island, Colombia, observed this fish to have a mean recruitment of 0.01+/-0.2 settling individuals with an average size of 23.0+/-0.0 mm (Mora and Zapata 2002). It is abundant at Gorgona and El Slavador, and along much of the continental tropical eastern Pacific coast south of the Gulf of California; moderately common off the offshore tropical eastern Pacific islands and Gulf of California. Densities in the southern part of its continental range are considerably higher than observed at any site surveyed in the Indo-West Pacific.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Acanthurus xanthopterus is of minor importance in commercial fisheries and in the aquarium trade. There may be some localized population declines from fishing.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range. In Queensland, Australia, there is a recreational catch limit of five per species and a minimum size limit of 25 cm (Department of Primary Industries accessed 8 April 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus xanthopterus

The yellowfin surgeonfish or Cuvier's surgeonfish, Acanthurus xanthopterus, is one of several marine fish that change color as they get older. This characteristic confused fish identification, and originally put the young and adults in different species. With the arrival of aquaria and later, coral reef aquaculture, specialists noticed the color transformation. Only recently have zoologists begun to understand their metamorphosis.

Physical description[edit]

It ranges in length to 70 cm (28 in). It has eight or 9 dorsal spines, 25-27 dorsal soft rays, three anal spines, 23-25 anal soft rays, and 16-24 anterior and 17-22 posterior gill rakers.[1]

Its body is purplish gray. It has a region of dull yellow in front of its eye. The outer third of its pectoral fin is yellow, the extreme distal part is hyaline. Its dorsal and anal fins are yellowish grey basally and dull yellow distally. Its caudal fin is purplish and the caudal spine is small.[1]

Range and habitat[edit]

It lives near coral reefs at depths ranging from 5–90 m (16–300 ft). Its preferred temperatures are 24–28°C (75–82°F) at latitudes of 30°N to 30°S. It ranges from East Africa to the Hawaiian Islands and French Polynesia, north to southern Japan, south to the Great Barrier Reef, and New Caledonia, and in the Eastern Pacific, from the lower Gulf of California and Clipperton Island to Panama and the Galapagos Islands.[1]

Juveniles inhabit shallow, protected, turbid inshore waters, while adults prefer deeper areas of protected bays and lagoons.

Feeding[edit]

It feeds on diatoms, detritus film of sand, filamentous algae, hydroids, and pieces of fish. It is probably the only surgeonfish that readily takes bait.[1]

References[edit]

  1. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2007). "Acanthurus xanthopterus" in FishBase. October 2007 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!