Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Oceanic and non-vertical migrant (Ref. 4739). Mesopelagic at 275-1200 m (Ref. 58302). Commonly found in 500-800 m both day and night (Ref. 4054). Possibly a cyclic feeder of copepods, ostracods, euphausiids, amphipods, fishes and other taxa (Ref. 4739). Adult photophore complement acquired at 11-13 mm SL (Ref. 4739). Lipid content 1.4 % in fresh body weight and wax ester is 4.2 % in total lipids (Ref. 9193).
  • Quéro, J.-C., J.C. Njock and M.M. de la Hoz 1990 Sternoptychidae. p. 275-282. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4462)   http://www.fishbase.org/references/FBRefSummary.php?id=4462&speccode=40 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

References

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Off Panama [Caribbean Sea, Western Atlantic, 11°6'N, 78°21'W] [original locality Jamaica].

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type specimen(s)

Neotype: MCZ 46402.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Dorsal-fin rays 9–11; anal-fin rays 14–16; pectoral-fin rays10–11; total gill rakers 7–8 (rarely 9); vertebrae 29 (rarely 30). Medium size species, seldom exceeds 55 mm SL; trunk very broad; its depth usually greater than its length; dorsal spine long, its length greater or equal to dorsal fin length; posterior anal pterygiophores short, little extension behind and on same level with anal photophores; supra-anal photophore low, not reaching more than one-half the distance from ventral body margin to midline, no body margin extension in front of anal photophores; jaws medium to small; teeth short and low; gill raker tooth plates with low spinate ridges; anterior dorsal surface of tongue with small nodules; postabdominal and anal pterygiophore spines usually shorter than others in genus; in preservative pigment dark dorsally, often light and dispersed in trunk region, usually little pigment present at base of caudal rays.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Main Reference

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Broadly distributed in the Atlantic, caught in moderate numbers in the South Atlantic off Brazil and from 20˚N to the African coast at about 35˚S; abundantly present in the Gulf of Guinea and the tropical Atlantic; taken abundantly in the southern Caribbean, the Gulf of Mexico, and Straits of Florida; taken in the western North Atlantic; a large population occurs in the north eastern Atlantic from 25°N to 45°N latitude. In the western Indian Ocean small to moderate catches extend from 5 °S to 35°S latitude, a single catch has been observed from the eastern Indian Ocean; numerous catches indicate this species present south of Java, near Borneo, and in the Banda Sea; known also between New Guinea and the Solomon Islands, it occurs in the western Pacific near the Philippines and along the coast of Japan, with a small sample taken in the North Pacific; this species occurs in small numbers off lower California; has been reported abundantly southeast of Hawaii; a large population extends across the South Pacific from Chile to about 160° W longitude.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Grand Bank to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic, Indian and Pacific: mainly tropical regions (Ref. 47377). Eastern Atlantic: scattered records southwest of Ireland, also from Spain south to Angola. South China Sea and East China Sea (Ref.74511).
  • Quéro, J.-C., J.C. Njock and M.M. de la Hoz 1990 Sternoptychidae. p. 275-282. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4462)   http://www.fishbase.org/references/FBRefSummary.php?id=4462&speccode=40 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 9 - 11; Analspines: 0; Analsoft rays: 12 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 46 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

5.5 cm SL (male/unsexed; (Ref. 47377))
  • Figueiredo, J.L. de, A.P. dos Santos, N. Yamaguti, R.A. Bernardes and C.L. Del Bianco Rossi-Wongtschowski 2002 Peixes da zona econômica exclusiva da Região Sudeste-Sul do Brasil: Levantamento com Rede de Meia-Água. São-Paulo: Editora da Universidade de São Paulo; Imprensa Oficial do Estado, 242 p. (Ref. 47377)   http://www.fishbase.org/references/FBRefSummary.php?id=47377&speccode=205 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

To about 55 mm SL.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Triangular transparent membrane present above anal fin base (Ref. 13608).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Differs from S. pseudobscura by its smaller mouth, shorter teeth and no gill-raker tooth plate spines; markedly lower supra-anal photophore; relatively short anal pterygiophores not extending to level with anal photophores. Differs from S. obscura short dorsal spine and relatively short body depth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Found at depths of 500- 800 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 400 - 3676 m (Ref. 26165), usually 500 - 800 m (Ref. 47377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 553 specimens in 1 taxon.
Water temperature and chemistry ranges based on 515 samples.

Environmental ranges
  Depth range (m): 0 - 5041
  Temperature range (°C): 0.582 - 22.868
  Nitrate (umol/L): 0.158 - 44.278
  Salinity (PPS): 33.836 - 36.622
  Oxygen (ml/l): 0.303 - 6.468
  Phosphate (umol/l): 0.034 - 3.485
  Silicate (umol/l): 0.829 - 156.134

Graphical representation

Depth range (m): 0 - 5041

Temperature range (°C): 0.582 - 22.868

Nitrate (umol/L): 0.158 - 44.278

Salinity (PPS): 33.836 - 36.622

Oxygen (ml/l): 0.303 - 6.468

Phosphate (umol/l): 0.034 - 3.485

Silicate (umol/l): 0.829 - 156.134
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distributed between 400 m and 1200 m; major concentrations occur between 700 m and 900 m; no diurnal movement or marked geographical depth variation could be detected by Baird (1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 400 - 3676m.
From 400 to 3676 meters.

Habitat: bathypelagic. Oceanic and non-vertical migrant. Commonly found in 500-800 m both day and night (Ref. 4054). Possibly a cyclic feeder of small crustaceans (copepods, ostracods, euphausiids, amphipods, etc.), fishes and other taxa. Dioecious, adult photophore complement acquired at 11-13 mm SL (Ref. 4739). Lipid content 1.4 % in fresh body weight and wax ester is 4.2 % in total lipids (Ref. 9193).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oceanic and non-vertical migrant (Ref. 4739). Commonly found in 500-800 m both day and night (Ref. 4054). Possibly a cyclic feeder of copepods, ostracods, euphausiids, amphipods, fishes and other taxa (Ref. 4739). Feed on fewer but larger prey items from regions of cooler overlying water massess and diet was less diverse than that of fish from warmer waters (Ref. 54153). Larger specimens feed on larger food items. Feeding strategy appears to involve capture of the nearest "available" prey within its immediate vicinity (Ref. 54153).Adult photophore complement acquired at 11-13 mm SL (Ref. 4739). Lipid content 1.4 % in fresh body weight and wax ester is 4.2 % in total lipids (Ref. 9193).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on copepods, ostracods, euphausiids, amphipods and fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sternoptyx diaphana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCCGGCATAGTCGGCACAGCTCTTAGTTTATTAATTCGTGCGGAATTAAGTCAGCCGGGCGCTCTTCTAGGAGACGACCAAATTTATAATGTCATTGTTACTGCACATGCGTTTGTGATGATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGTAACTGGCTAATCCCTCTTATAATCGGGGCGCCTGATATGGCTTTTCCTCGAATAAATAACATGAGTTTCTGGCTTCTTCCTCCATCCTTCCTTCTTCTGTTGGCTTCATCAGGTGTGGAGGCTGGGGCTGGAACAGGTTGGACTGTTTACCCTCCTCTTGCTGGAAACTTGGCTCATGCAGGGGCATCTGTTGATCTAACCATCTTCTCTTTACATTTGGCGGGTATCTCCTCAATTTTGGGGGCCATTAATTTTATTACCACTATTGTTAATATAAAGCCTGCGGGTATATCTCAGTATCAGACTCCTTTATTTGTATGAGCGGTTCTTGTTACTGCTGTTCTTCTTCTTTTGTCGCTGCCAGTATTGGCTGCTGGTATTACAATGCTTTTGACAGATCGGAACTTAAACACAACGTTTTTTGATCCGGCAGGAGGAGGGGATCCTATTCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sternoptyx diaphana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!