Overview

Comprehensive Description

Biology

Inhabits deep waters on rocky substrata. One of the most common deepwater groupers caught with handlines at the Marianas.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean: western Pacific to French Polynesia. Reported as Epinephelus truncatus from French Polynesia by Bagnis et al. (1972, Ref. 4821).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Saloptia powelli is distributed within the South China Sea and western Pacific to French Polynesia. It has been reported from Taiwan, Okinawa (Japan), Mariana Islands, Society Islands, American Samoa, Samoa, Cook Islands, Federated States of Micronesia, French Polynesia, Fiji, Kiribati, New Caledonia, Niue, Palau, Papua New Guinea, Solomon Islands, South China Sea, Tokelau, Tonga, Tuvalu, Tuamotu Islands, Vanuatu (Heemstra and Randall 1993, Dalzell and Preston 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 390 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

39.0 cm SL (male/unsexed; (Ref. 5222))
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 140 - 367 m (Ref. 4787)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
General
Saloptia powelli is found on rocky substrates in deep water. Nothing is known or published on its biology.

Fisheries-dependent
Saloptia powelli is captured by dropline fishing in 100 to 200 m depth in Pacific Island countries (Dalzell and Preston 1992). It is an important component of the deep water handline fishery in the Marianas (Polovina and Ralston 1987).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 366 - 366
  Temperature range (°C): 12.960 - 12.960
  Nitrate (umol/L): 12.444 - 12.444
  Salinity (PPS): 34.882 - 34.882
  Oxygen (ml/l): 4.101 - 4.101
  Phosphate (umol/l): 1.079 - 1.079
  Silicate (umol/l): 6.301 - 6.301
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 140 - 367m.
From 140 to 367 meters.

Habitat: demersal. Inhabits deep waters on rocky substrata. One of the most common deepwater groupers caught with handlines at the Marianas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Saloptia powelli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTGCTTATTCGAGCAGAACTGAGTCAACCCGGCGCTCTTTTAGGCGATGACCAAATCTACAATGTTATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAATTGACTTATTCCTTTAATGATCGGTGCCCCAGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTTCTGCCCCCTTCCTTCCTTCTTCTACTTGCCTCATCCGGTGTCGAAGCAGGGGCCGGAACAGGGTGAACAGTCTACCCCCCTTTAGCCGGAAACCTAGCCCACGCAGGAGCATCCGTTGACCTAACTATCTTCTCCCTGCACTTAGCAGGTATTTCATCTATTCTAGGGGCAATCAATTTTATTACTACTATTATTAATATGAAACCCCCTGCTATCTCCCAATACCAAACACCCCTATTCGTATGAGCTGTCCTAATTACTGCCGTCCTTCTTCTACTTTCCCTGCCAGTTCTAGCAGCCGGAATTACAATGCTCCTGACAGACCGAAATCTTAATACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTTTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Saloptia powelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Samoilys, M., Choat, J.H. & Rocha, L.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
There is insufficient data on population trends to assess the population or fisheries status of this species and it is, therefore, assessed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
General
No current information on population trends or abundance for Saloptia powelli.

Fisheries-dependent data
Saloptia powelli was considered a virgin stock in the 1970s to 1980s (Dalzell and Preston 1992). It is taken in deep water drop line and handline fisheries throughout most of the Pacific; in the Cook Islands this species dominated the grouper catch (Polovina and Ralston 1987, Dalzell and Preston 1992). It is likely to be taken in any deep water fisheries within its range and is specifically is targeted in Japan.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The greatest threat to Saloptia powelli is overfishing. It is not protected through any conservation measures (beyond the depth range of many marine protected areas), therefore research is recommended to assess this interesting monotypic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no current conservation measures is in place for Saloptia powelli and no marine protected areas occur within its depth range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!