Overview
Comprehensive Description
Biology
Inhabits deep waters on rocky substrata. One of the most common deepwater groupers caught with handlines at the Marianas.
-
Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12
Trusted
Distribution
Pacific Ocean: western Pacific to French Polynesia. Reported as Epinephelus truncatus from French Polynesia by Bagnis et al. (1972, Ref. 4821).
-
Randall, J.E. and P.C. Heemstra 1991 Revision of Indo-Pacific groupers (Perciformes: Serranidae: Epinephelinae), with descriptions of five new species. Indo-Pac. Fish. (20):332 p. (Ref. 4787)
http://www.fishbase.org/references/FBRefSummary.php?id=4787&speccode=4826
Trusted
Range Description
Saloptia powelli is distributed within the South China Sea and western Pacific to French Polynesia. It has been reported from Taiwan, Okinawa (Japan), Mariana Islands, Society Islands, American Samoa, Samoa, Cook Islands, Federated States of Micronesia, French Polynesia, Fiji, Kiribati, New Caledonia, Niue, Palau, Papua New Guinea, Solomon Islands, South China Sea, Tokelau, Tonga, Tuvalu, Tuamotu Islands, Vanuatu (Heemstra and Randall 1993, Dalzell and Preston 1992).
Trusted
Physical Description
Morphology
Dorsal spines (total): 8; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 8
-
Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12
Trusted
Size
Max. size
39.0 cm SL (male/unsexed; (Ref. 5222))
-
Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)
http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 140 - 367 m (Ref. 4787)
-
Randall, J.E. and P.C. Heemstra 1991 Revision of Indo-Pacific groupers (Perciformes: Serranidae: Epinephelinae), with descriptions of five new species. Indo-Pac. Fish. (20):332 p. (Ref. 4787)
http://www.fishbase.org/references/FBRefSummary.php?id=4787&speccode=4826
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
General
Saloptia powelli is found on rocky substrates in deep water. Nothing is known or published on its biology.
Fisheries-dependent
Saloptia powelli is captured by dropline fishing in 100 to 200 m depth in Pacific Island countries (Dalzell and Preston 1992). It is an important component of the deep water handline fishery in the Marianas (Polovina and Ralston 1987).
Saloptia powelli is found on rocky substrates in deep water. Nothing is known or published on its biology.
Fisheries-dependent
Saloptia powelli is captured by dropline fishing in 100 to 200 m depth in Pacific Island countries (Dalzell and Preston 1992). It is an important component of the deep water handline fishery in the Marianas (Polovina and Ralston 1987).
Systems
- Marine
Trusted
Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 366 - 366
Temperature range (°C): 12.960 - 12.960
Nitrate (umol/L): 12.444 - 12.444
Salinity (PPS): 34.882 - 34.882
Oxygen (ml/l): 4.101 - 4.101
Phosphate (umol/l): 1.079 - 1.079
Silicate (umol/l): 6.301 - 6.301
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 366 - 366
Temperature range (°C): 12.960 - 12.960
Nitrate (umol/L): 12.444 - 12.444
Salinity (PPS): 34.882 - 34.882
Oxygen (ml/l): 4.101 - 4.101
Phosphate (umol/l): 1.079 - 1.079
Silicate (umol/l): 6.301 - 6.301
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 140 - 367m.
From 140 to 367 meters.
Habitat: demersal. Inhabits deep waters on rocky substrata. One of the most common deepwater groupers caught with handlines at the Marianas.
From 140 to 367 meters.
Habitat: demersal. Inhabits deep waters on rocky substrata. One of the most common deepwater groupers caught with handlines at the Marianas.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Saloptia powelli
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTGCTTATTCGAGCAGAACTGAGTCAACCCGGCGCTCTTTTAGGCGATGACCAAATCTACAATGTTATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAATTGACTTATTCCTTTAATGATCGGTGCCCCAGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTTCTGCCCCCTTCCTTCCTTCTTCTACTTGCCTCATCCGGTGTCGAAGCAGGGGCCGGAACAGGGTGAACAGTCTACCCCCCTTTAGCCGGAAACCTAGCCCACGCAGGAGCATCCGTTGACCTAACTATCTTCTCCCTGCACTTAGCAGGTATTTCATCTATTCTAGGGGCAATCAATTTTATTACTACTATTATTAATATGAAACCCCCTGCTATCTCCCAATACCAAACACCCCTATTCGTATGAGCTGTCCTAATTACTGCCGTCCTTCTTCTACTTTCCCTGCCAGTTCTAGCAGCCGGAATTACAATGCTCCTGACAGACCGAAATCTTAATACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCAATCCTTTACCAACATCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Saloptia powelli
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
DD
Data Deficient
Red List Criteria
Version
3.1
Year Assessed
2008
Assessor/s
Samoilys, M., Choat, J.H. & Rocha, L.
Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)
Contributor/s
Justification
There is insufficient data on population trends to assess the population or fisheries status of this species and it is, therefore, assessed as Data Deficient.
Trusted
Trends
Population
Population
Population Trend
General
No current information on population trends or abundance for Saloptia powelli.
Fisheries-dependent data
Saloptia powelli was considered a virgin stock in the 1970s to 1980s (Dalzell and Preston 1992). It is taken in deep water drop line and handline fisheries throughout most of the Pacific; in the Cook Islands this species dominated the grouper catch (Polovina and Ralston 1987, Dalzell and Preston 1992). It is likely to be taken in any deep water fisheries within its range and is specifically is targeted in Japan.
No current information on population trends or abundance for Saloptia powelli.
Fisheries-dependent data
Saloptia powelli was considered a virgin stock in the 1970s to 1980s (Dalzell and Preston 1992). It is taken in deep water drop line and handline fisheries throughout most of the Pacific; in the Cook Islands this species dominated the grouper catch (Polovina and Ralston 1987, Dalzell and Preston 1992). It is likely to be taken in any deep water fisheries within its range and is specifically is targeted in Japan.
Population Trend
Unknown
Trusted
Threats
Data deficient (DD)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Major Threats
The greatest threat to Saloptia powelli is overfishing. It is not protected through any conservation measures (beyond the depth range of many marine protected areas), therefore research is recommended to assess this interesting monotypic species.
Trusted
Management
Conservation Actions
Conservation Actions
There are no current conservation measures is in place for Saloptia powelli and no marine protected areas occur within its depth range.
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: highly commercial; gamefish: yes; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
-
Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
http://www.fishbase.org/references/FBRefSummary.php?id=171&speccode=2534
-
Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
http://www.fishbase.org/references/FBRefSummary.php?id=30874&speccode=10294
Trusted


