Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits rocky reefs; also found on muddy grounds. Juveniles occur in shallow waters. Commercially cultured in Japan.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Epinephelus bruneus is narrowly distributed from the coasts of the Republic of Korea, Japan (north to Hegura-jima Island, 37°50’N), China (north to Shanghai, south to Hong Kong and Hainan Island), and Taiwan (Heemstra and Randall 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Pacific: Korea, Japan (north to Hegura-jima Island), China (south to Hong Kong and Hainan Island), and Taiwan.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

128 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 33.0 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
E. bruneus inhabits rocky reefs and mud bottoms (Heemstra and Randall 1993). Adults can be found in depths of 20 to 200 m, while juveniles occur in shallow water (Heemstra and Randall 1993). The maximum size ofE. bruneus recorded is 136 cm TL (38 kg) (Jason Schratwieser, IGFA World Records, pers. comm. 12 Jan 2007).

Spawning
According to fishermen, does not take baits readily during summer and the gonads of E. bruneus are empty, indicating a “spent” (post-reproductive) condition (Chan 1968).

No information is available on sexual pattern, fecundity or recruitment.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 20 - 200 m (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 200m.
From 20 to 200 meters.

Habitat: reef-associated. Inhabits rocky reefs; also found on muddy grounds. Juveniles occur in shallow waters. Commercially cultured in Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits rocky reefs and muddy grounds (Ref. 5222); also from coral reefs (Ref. 58534). Juveniles occur in shallow waters (Ref. 5222).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus bruneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGGCCATTACACGTTGATTTTTCTCGACTAATCACAAAGACATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACAGCCCTCAGCCTGCTAATTCGAGCTGAGCTAAGCCAACCCGGGGCTCTACTAGGCGACGACCAGATCTATAACGTAATTGTTACAGCACACGCTTTTGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTTATCCCACTTATAATTGGTGCCCCAGACATAGCATTCCCTCGAATGAATAATATGAGCTTCTGACTTCTTCCCCCATCTTTCCTGCTTCTTCTTGCTTCTTCTGGGGTAGAAGCTGGTGCCGGTACTGGCTGAACGGTCTACCCGCCCTTAGCCGGAAACCTAGCCCATGCAGGTGCATCCGTAGACTTAACCATCTTCTCATTACACTTAGCAGGAATTTCATCAATTCTAGGTGCAATTAACTTTATTACAACCATCATTAACATGAAACCCCCTGCCATCTCTCAATACCAAACGCCTCTATTTGTGTGAGCAGTGTTAATTACAGCAGTGCTTCTGCTCCTCTCTCTTCCTGTTCTTGCCGCTGGCATTACAATGTTACTTACAGATCGTAACCTTAACACCACTTTCTTTGACCCCGCCGGAGGGGGAGACCCGATTCTTTACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTCTACATTTTAATTCTCCCTGGCTTCGGAATGATCTCCCATATCGTTGCATACTACTCTGGGAAAAAAGAACCTTTCGGCTATATAGGAATGGTTTGAGCCATGATGGCAATCGGCCTTTTAGGTTTCATCGTATGAGCACACCACATATTTACAGTTGGAATGGACGTAGATACACGCGCTTACTTTACATCAGCCACTATAATCATCGCAATCCCCACTGGCGTCAAAGTCTTCAGCTGATTAGCCACACTCCACGGAGGATCCATTAAATGAGAAACCCCCCTTCTATGAGCACTTGGCTTTATTTTCCTCTTTACAGTAGGAGGTTTAACAGGAATTGTCCTAGCTAATTCTTCACTTGATATTGTCCTACACGACACATACTATGTAGTTGCCCACTTCCACTATGTACTCTCAATAGGAGCTGTATTCGCCATCGTAGCTGCCTTCGTACACTGATTCCCACTATTCACAGGCTACACCCTCCACAGCACTTGGACAAAAATCCACTTTGGCATTATGTTCGTAGGTGTAAACCTTACCTTCTTCCCACAACACTTCCTGGGGCTAGCCGGAATGCCTCGTCGATACTCAGACTACCCAGACGCCTATACCCTATGAAATACCGTCTCTTCTATTGGCTCCATAATCTCACTCGTAGCCGTAATCATATTCCTTTTCATCATTTGAGAAGCATTTGCTTCTAAACGTGAAGTCCTTGCAGTAGAACTGACCACAACCAACGTAGAATGACTCCACGGCTGCCCTCCCCCATATCACACATTTGAGGAGCCCGCATTTGTTCAAATTCGACCACACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus bruneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4d

Version
3.1

Year Assessed
2008

Assessor/s
Thierry, C., Sadovy, Y. & To, A.W.L.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus bruneus is listed as Vulnerable on the basis of a decline of at least 30% in the southern half of its relatively narrow range. Bottom trawling within its habitat along the coast of China is intensive. Fishing pressure appears to be increasing and declines are inferred in other parts of its range. Across its range, there is little fisheries management, thus, further declines in abundance are inferred.

History
  • 2007
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
General
Little information is currently available for this species across most of its range, although it has been previously abundant in regional fisheries. The species is occasionally seen in local Hong Kong markets (Sadovy Y, pers. comm.).

Abundance
E. bruneus was one of the most abundant species in Hong Kong waters in 1968 (Chan 1968). E. bruneus was available in markets throughout the year, with highest abundance from October to May (Chan 1968). Wilson (2003) frequently observed E. bruneus on Hong Kong artificial reefs. Sadovy and Cornish (2000) later described E. bruneus as one of the rarest grouper in Hong Kong, especially for fish larger than 50 cm TL.

Fishery-independent data
Hong Kong
Wilson (2003) stated that E. bruneus could be found on artificial reefs frequently. Sadovy and Cornish (2000) occasionally recorded E. bruneus during underwater observations (one 30 cm TL fish in a shallow coral area at about 3 m and a larger individual around large boulders at depth of 15 m).

Fishery-dependent data
No fishery-dependent data is available. No data are available on the sex composition or length-age relationship.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat to E. bruneus is fishing. The species is vulnerable to a wide range of gear types, including long-liners, trawlers and hand-liners (Chan 1968). Fishing on both juveniles and adults contributes to this threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (A4d), IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Not known to occur in any enforced marine protected areas. There are no specific conservative measures for E. bruneus.

A more up-to-date stock assessment is crucial in determining abundance and population trends. More information on its stock, biology, age-and-growth and management practices is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!