Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: brotula (English), congrio (Espanol)
 
Brotula multibarbata Temminck and Schlegel, 1846

Goatsbeard brotula



Body elongate, relatively deep, compressed, tapering to rear; eye large; nostril halfway between top lip and rear nostril; eye relatively large (diameter > space between eyes);  mouth large; gill openings large, membranes not joined under throat; small pointed teeth in bands on jaws and roof of mouth; snout and lower jaw each with 6 barbels; pointed tail fin continuous with dorsal and anal; dorsal fin origin before anal fin origin;  dorsal rays 109-139; anal rays 80-106; pectoral 22-26; each pelvic fin is a 2-rayed filament, origin under throat; scales small, smooth, slightly overlapping, on head and completely covering body.


Body uniform grey to reddish brown, barbels on snout and thin pale; dorsal and anal fins with black edges bordered by a thin white outer band; juveniles similar to adults or sometimes with scattered small black spots on the body, particularly near the bases of the dorsal and anal fins, and on the median fins.


Size: attains 100 cm.

Inhabits rocky reefs and adjacent sand bottoms.

Depth: 1-650 m.

Indo-central Pacific; in the eastern Pacific known only from two juveniles collected on the reef at Clipperton in 1998.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Benthopelagic on shelf and upper slope (Ref. 34024). Larvae found in the epipelagic far offshore (Ref. 34024). Found in shallow lagoon and seaward reefs and occurs at depths of at least 220 m. Adults (30-90 cm) move to depths of 100-650 m (Ref. 58472). A nocturnal species, rarely seen for it lives in caves and crevices during the day and periodically emerges from cover at night to feed on crustaceans, mainly crabs, and fishes. Oviparous, with oval pelagic eggs floating in a gelatinous mass (Ref. 205). Utilized fresh and eaten steamed, pan-fried and baked (Ref. 9987). Also Ref. 58302.
  • Nielsen, J.G., D.M. Cohen, D.F. Markle and C.R. Robins 1999 Ophidiiform fishes of the world (Order Ophidiiformes). An annotated and illustrated catalogue of pearlfishes, cusk-eels, brotulas and other ophidiiform fishes known to date. FAO Fish. Synop. 125(18):178p. Rome: FAO. (Ref. 34024)   http://www.fishbase.org/references/FBRefSummary.php?id=34024&speccode=65 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to Pitcairn, north to southern Japan, south to Lord Howe Island.
  • Nielsen, J.G., D.M. Cohen, D.F. Markle and C.R. Robins 1999 Ophidiiform fishes of the world (Order Ophidiiformes). An annotated and illustrated catalogue of pearlfishes, cusk-eels, brotulas and other ophidiiform fishes known to date. FAO Fish. Synop. 125(18):178p. Rome: FAO. (Ref. 34024)   http://www.fishbase.org/references/FBRefSummary.php?id=34024&speccode=65 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to Rowley Shoals (Western Australia), New Caledonia and Lord How
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 650 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 109 - 139; Analspines: 0; Analsoft rays: 80 - 106
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 100.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 5213))
  • Fischer, W., I. Sousa, C. Silva, A. de Freitas, J.M. Poutiers, W. Schneider, T.C. Borges, J.P. Feral and A. Massinga 1990 Fichas FAO de identificaçao de espécies para actividades de pesca. Guia de campo das espécies comerciais marinhas e de águas salobras de Moçambique. Publicaçao preparada em collaboraçao com o Instituto de Investigaçao Pesquiera de Moçambique, com financiamento do Projecto PNUD/FAO MOZ/86/030 e de NORAD. Roma, FAO. 1990. 424 p. (Ref. 5213)   http://www.fishbase.org/references/FBRefSummary.php?id=5213&speccode=151 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits shallow lagoon and seaward reefs and occurs at depths of at least 220 m. May be found at 650 m (Ref. 5213). Rarely seen for it lives in caves and crevices during the day and periodically emerges from cover at night to feed on crustaceans, mainly crabs, and fishes. Utilized fresh and eaten steamed, pan-fried and baked (Ref. 9987).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In addition to meristic counts, B. multibarbata differs from B. townsendi by possessing a larger eye (width>interorbital space) and having slightly different coloration (dark brown with a submarginal black band and narrow white border on the dorsal and anal fins versus greenish to orange brown with orange-bordered dorsal and anal fins).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Brotula marginalis
Catalog Number: USNM 49694
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): T. Wood
Locality: Hawaiian Islands, Hawaii, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 650 m (Ref. 34024), usually 180 - 220 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 104 specimens in 1 taxon.
Water temperature and chemistry ranges based on 54 samples.

Environmental ranges
  Depth range (m): 0.5 - 1035
  Temperature range (°C): 23.154 - 29.336
  Nitrate (umol/L): 0.019 - 1.204
  Salinity (PPS): 33.507 - 36.101
  Oxygen (ml/l): 4.415 - 4.891
  Phosphate (umol/l): 0.092 - 0.351
  Silicate (umol/l): 0.888 - 3.408

Graphical representation

Depth range (m): 0.5 - 1035

Temperature range (°C): 23.154 - 29.336

Nitrate (umol/L): 0.019 - 1.204

Salinity (PPS): 33.507 - 36.101

Oxygen (ml/l): 4.415 - 4.891

Phosphate (umol/l): 0.092 - 0.351

Silicate (umol/l): 0.888 - 3.408
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 650m.
Recorded at 650 meters.

Habitat: reef-associated. Inhabits shallow lagoon and seaward reefs and occurs at depths of at least 220 m. Rarely seen for it lives in caves and crevices during the day and periodically emerges from cover at night to feed on crustaceans, mainly crabs, and fishes. Utilized fresh and eaten steamed, pan-fried and baked (Ref. 9987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Is a diurnally secretive species. Swims out on the reef after dark but is mostly exposed only during transit from one crevice to another (Ref. 13550). Benthopelagic on shelf and upper slope (Ref. 34024). Larvae found in the epipelagic far offshore (Ref. 34024). Found in shallow lagoon and seaward reefs and occurs at depths of at least 220 m. Adults (30-90 cm) move to depths of 100-650 m (Ref. 58472). A nocturnal species, rarely seen for it lives in caves and crevices during the day and periodically emerges from cover at night to feed on crustaceans, mainly crabs, and fishes. Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brotula multibarbata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATATAGTATTTGGTGCTTGAGCCGGAATAGTCGGTACTGCTCTTAGCCTACTAATCCGAGCAGAACTCAGTCAACCAGGAGCCCTTCTTGGAGATGACCAAATTTATAATGTCATTGTTACAGCCCATGCTTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTTGGAAACTGGTTAATTCCACTTATGATTGGAGCCCCAGACATGGCATTCCCCCGAATGAACAACATAAGCTTCTGGCTTCTTCCTCCCTCATTCCTTCTTCTGCTGGCCTCATCAGGAGTTGAAGCCGGGGCTGGTACTGGGTGAACTGTATATCCGCCCCTTGCTGGAAACTTAGCCCATGCAGGAGCATCTGTAGATCTTACTATCTTCTCCCTTCATCTGGCAGGGGTATCATCTATTCTAGGGGCCATTAACTTCATTACAACAATTATTAACATGAAACCCCCCGCAATTTCGCAATACCAAACACCTTTATTCGTATGAGCCGTTCTAATTACTGCAGTACTTCTTCTTCTTTCTTTACCAGTCCTTGCTGCAGGAATTACAATGCTTCTAACAGATCGAAACCTTAACACCACTTTCTTTGACCCCGCTGGAGGAGGTGATCCTATCTTATACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brotula multibarbata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!