Overview

Comprehensive Description

Biology

Lives among staghorn Acropora corals in lagoons and hovers among or above the branches and also rests on them (Ref. 1602, 48637); a coral-commensal species (Ref. 72446). Occurs in aggregations of 5-15 individuals.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: north to southern Japan, south to Rowley Shoals and the southern Great Barrier Reef. Palau and Marshall Islands in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 10 - 11; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 35 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

3.5 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by uniform bright yellow color; absence of scales; complete pelvic fin frenum and basal membrane; depth of body at level of pelvic fins 2.7-3.5 in SL (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine, usually 2 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 0.9 - 8.5
  Temperature range (°C): 25.709 - 28.954
  Nitrate (umol/L): 0.090 - 0.923
  Salinity (PPS): 34.131 - 35.312
  Oxygen (ml/l): 4.525 - 4.727
  Phosphate (umol/l): 0.113 - 0.141
  Silicate (umol/l): 0.983 - 1.579

Graphical representation

Depth range (m): 0.9 - 8.5

Temperature range (°C): 25.709 - 28.954

Nitrate (umol/L): 0.090 - 0.923

Salinity (PPS): 34.131 - 35.312

Oxygen (ml/l): 4.525 - 4.727

Phosphate (umol/l): 0.113 - 0.141

Silicate (umol/l): 0.983 - 1.579
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Lives among staghorn Acropora corals in lagoons and hovers among or above the branches and also rests on them (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gobiodon okinawae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAGTTTTTGGTGCCTGGGCCGGGATAGTAGGAACTGCTTTAAGCCTGCTCATTCGAGCCGAGCTTAGCCAACCCGGGGCGCTGCTTGGGGACGACCAGGTCTATAACGTAATCGTCACTGCGCACGCCTTTGTGATGATCTTCTTTATAGTAATGCCAATCATGATTGGGGGGTTTGGGAATTGGCTAATTCCCTTGATGATTGGTGCCCCCGACATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGGCTCCTTCCCCCCTCTTTTCTTCTCTTACTCGCATCTTCAGGCGTTGAAGCAGGGGCAGGAACAGGATGGACCGTTTATCCACCGCTAGCCGGCAATCTTGCTCACGCCGGAGCATCTGTCGACCTAACCATCTTTTCTCTTCACCTTGCAGGTATTTCTTCTATTCTAGGGGCAATTAACTTCATTACTACGATTCTTAACATAAAACCCCCCGCCATCTCTCAATACCAAACACCCCTGTTCGTCTGAGCTGTACTAATTACAGCCGTACTACTACTCCTTTCTCTTCCAGTCCTTGCTGCCGGGATTACAATGCTCCTCACAGACCGAAACCTTAACACAACCTTCTTTGACCCTGCAGGCGGAGGAGACCCTATTCTCTACCAGCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon okinawae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!