Articles on this page are available in 1 other language: Spanish (1) (learn more)
Overview
Comprehensive Description
Biology
Feeds on krill, squid and fishes.
-
Gon, O. 1990 Lampridae. p. 215-217. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5188)
http://www.fishbase.org/references/FBRefSummary.php?id=5188&speccode=1072
Trusted
Brief Review of Lampris immaculatus
Lampris immaculatus is a species of fish. It is an active predator, and lives in all oceans except the antarctic ocean.
Unreviewed
Distribution
Circumglobal in the southern hemisphere between 34°S and the Antarctic Polar Front.
-
Gon, O. 1990 Lampridae. p. 215-217. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5188)
http://www.fishbase.org/references/FBRefSummary.php?id=5188&speccode=1072
Trusted
New Zealand Exclusive Economic Zone
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 55 - 56; Analspines: 0; Analsoft rays: 36 - 40
-
Heemstra, P.C. 1986 Lampridae. p. 398. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 6475)
http://www.fishbase.org/references/FBRefSummary.php?id=6475&speccode=7145
Trusted
Size
Max. size
110 cm TL (male/unsexed; (Ref. 6475)); max. published weight: 30.0 kg (Ref. )
-
Heemstra, P.C. 1986 Lampridae. p. 398. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 6475)
http://www.fishbase.org/references/FBRefSummary.php?id=6475&speccode=7145
Trusted
Ecology
Habitat
Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 315 - 315
Temperature range (°C): 2.042 - 2.042
Nitrate (umol/L): 30.467 - 30.467
Salinity (PPS): 34.143 - 34.143
Oxygen (ml/l): 5.864 - 5.864
Phosphate (umol/l): 2.231 - 2.231
Silicate (umol/l): 45.584 - 45.584
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 315 - 315
Temperature range (°C): 2.042 - 2.042
Nitrate (umol/L): 30.467 - 30.467
Salinity (PPS): 34.143 - 34.143
Oxygen (ml/l): 5.864 - 5.864
Phosphate (umol/l): 2.231 - 2.231
Silicate (umol/l): 45.584 - 45.584
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Trophic Strategy
Feeds on krill, squid and fishes. A large number of prey identified were from otolith or beak remains (Ref. 76749). The onychoteuthid squid Moroteuthis ingens was the most abundant prey item and occurred 93% of the stomachs examined (Ref. 76749). Relatively high occurrence of anthropogenic waste (plastic) was present in the stomachs of 10 fish (14% of total) (Ref. 76749).
-
Gon, O. 1990 Lampridae. p. 215-217. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5188)
http://www.fishbase.org/references/FBRefSummary.php?id=5188&speccode=1072
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lampris immaculatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTATATCTAGTATTCGGGGCCTGAGCCGGGATGGTCGGAACTGCCCTCAGCCTTCTAATCCGGGCTGAGCTCAGCCAACCAGGAGCCCTCCTGGGAGACGACCAGATCTATAACGTAATCGTCACCGCCCACGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATAATTGGAGGCTTTGGGAACTGATTAATCCCACTAATAATTGGCGCCCCTGATATGGCCTTTCCTCGGATAAATAATATGAGCTTCTGACTCCTTCCCCCCTCCTTCCTACTCCTCTTGGCCTCCTCAGGCGTAGAAGCCGGAGTAGGAACAGGCTGGACCGTATACCCACCCCTAGCAGGAAACCTGGCTCACGCAGGGGCCTCTGTTGATCTAGCCATTTTCTCCCTCCACCTGGCAGGAGTTTCTTCTATCCTTGGGGCAATTAATTTTATTACCACAATCATTAATATGAAACCCCCTGCTATCTCTCAATACCAAACCCCTCTATTCGTATGAGCAACCCTAATTACGGCTGTACTCCTTCTCCTCTCTCTCCCTGTTCTAGCCGCTGGAATTACAATACTCCTAACAGACCGAAATCTTAATACCACATTCTTTGACCCTTCTGGAGGGGGAGACCCCATCCTCTACCAACACTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Lampris immaculatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


