Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Feeds on krill, squid and fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brief Review of Lampris immaculatus

Lampris immaculatus is a species of fish. It is an active predator, and lives in all oceans except the antarctic ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: floluk floluk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal in the southern hemisphere between 34°S and the Antarctic Polar Front.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in Southern Hemisphere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 55 - 56; Analspines: 0; Analsoft rays: 36 - 40
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

110 cm TL (male/unsexed; (Ref. 6475)); max. published weight: 30.0 kg (Ref. )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 50 - 485 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 315 - 315
  Temperature range (°C): 2.042 - 2.042
  Nitrate (umol/L): 30.467 - 30.467
  Salinity (PPS): 34.143 - 34.143
  Oxygen (ml/l): 5.864 - 5.864
  Phosphate (umol/l): 2.231 - 2.231
  Silicate (umol/l): 45.584 - 45.584
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 50 - 485m.
From 50 to 485 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on krill, squid and fishes. A large number of prey identified were from otolith or beak remains (Ref. 76749). The onychoteuthid squid Moroteuthis ingens was the most abundant prey item and occurred 93% of the stomachs examined (Ref. 76749). Relatively high occurrence of anthropogenic waste (plastic) was present in the stomachs of 10 fish (14% of total) (Ref. 76749).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampris immaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTCGGGGCCTGAGCCGGGATGGTCGGAACTGCCCTCAGCCTTCTAATCCGGGCTGAGCTCAGCCAACCAGGAGCCCTCCTGGGAGACGACCAGATCTATAACGTAATCGTCACCGCCCACGCCTTTGTAATAATTTTCTTCATAGTCATGCCTATTATAATTGGAGGCTTTGGGAACTGATTAATCCCACTAATAATTGGCGCCCCTGATATGGCCTTTCCTCGGATAAATAATATGAGCTTCTGACTCCTTCCCCCCTCCTTCCTACTCCTCTTGGCCTCCTCAGGCGTAGAAGCCGGAGTAGGAACAGGCTGGACCGTATACCCACCCCTAGCAGGAAACCTGGCTCACGCAGGGGCCTCTGTTGATCTAGCCATTTTCTCCCTCCACCTGGCAGGAGTTTCTTCTATCCTTGGGGCAATTAATTTTATTACCACAATCATTAATATGAAACCCCCTGCTATCTCTCAATACCAAACCCCTCTATTCGTATGAGCAACCCTAATTACGGCTGTACTCCTTCTCCTCTCTCTCCCTGTTCTAGCCGCTGGAATTACAATACTCCTAACAGACCGAAATCTTAATACCACATTCTTTGACCCTTCTGGAGGGGGAGACCCCATCCTCTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lampris immaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!