Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Maximum depth reported at 1,186m (Ref. 57178). Minimum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Sub-Antarctic waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Atlantic: off Patagonia, the Falklands and the Burdwood Bank. Also reported from the Ob Bank, Kerguelen Islands, Crozet Islands, and the Campbell Plateau.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 131; Analspines: 0; Analsoft rays: 110; Vertebrae: 65
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 390 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

39.0 cm TL (male/unsexed; (Ref. 5000))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 21 - 1186 m (Ref. 5192)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 350 - 1200
  Temperature range (°C): 1.120 - 5.685
  Nitrate (umol/L): 22.122 - 36.792
  Salinity (PPS): 34.194 - 34.691
  Oxygen (ml/l): 4.130 - 5.716
  Phosphate (umol/l): 1.608 - 2.445
  Silicate (umol/l): 11.774 - 80.513

Graphical representation

Depth range (m): 350 - 1200

Temperature range (°C): 1.120 - 5.685

Nitrate (umol/L): 22.122 - 36.792

Salinity (PPS): 34.194 - 34.691

Oxygen (ml/l): 4.130 - 5.716

Phosphate (umol/l): 1.608 - 2.445

Silicate (umol/l): 11.774 - 80.513
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Achiropsetta tricholepis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTCGTATTTGGTGCCTGAGCCGGCATAGTAGGCACAGCCCTGAGCCTCCTAATCCGAGCAGAACTAAGCCAACCCGGCACTTTCCTGGGGGATGACCAGATCTATAATGTAATCGTAACAGCCCATGCTTTCGTAATAATCTTTTTCATGGTTATACCCCTGATAATCGGCGGATTCGGCAACTGACTTATTCCCCTTATGATCGGGGCTCCAGACATGGCATTTCCCCGAATAAACAACATAAGCTTTTGACTTCTTCCCCCCTCTTTCCTTCTCCTCCTGGCCTCTTCCGGGGTTGAGGCTGGAGCCGGGACCGGGTGAACAGTTTACCCCCCATTGTCCGGAAACCTCGCCCATGCGGGAGCATCCGTTGATTTAACAATCTTTTCCCTTCATCTAGCAGGCATTTCCTCGATCCTGGGGGCCATTAACTTCATTACTACCATTATCAATATGAAACCCACAACCATAACCATGTATCAGATTCCCCTGTTTGTCTGAGCTGTCCTAATTACAGCGGTACTTCTACTCCTCTCCCTTCCTGTTTTAGCTGCTGGTATTACCATGCTTCTAACAGATCGTAACTTGAACACCGCCTTCTTTGATCCAGCAGGAGGAGGTGACCCCATCTTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Achiropsetta tricholepis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Finless flounder

Achiropsetta tricholepis, the Finless flounder or Prickly flounder, is a species of southern flounder with a southern circumpolar distribution. It lives in the Southwest Atlantic Ocean off Patagonia, the Falkland Islands and the Burdwood Bank, and also off the Ob Bank, Kerguelen Islands, Crozet Islands, and the Campbell Plateau. It is usually caught in depths of 21 to 1,186 metres (69 to 3,891 ft). This species can grow to 39 centimetres (15 in) TL.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!