Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Southern Ocean: Antarctic continental shelf, South Shetland and South Orkney islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 230 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

23.0 cm SL (male/unsexed; (Ref. 5192))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 300 - 1250 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 446 - 1538
  Temperature range (°C): -1.828 - 0.688
  Nitrate (umol/L): 29.325 - 33.677
  Salinity (PPS): 34.495 - 34.811
  Oxygen (ml/l): 4.675 - 6.648
  Phosphate (umol/l): 2.137 - 2.491
  Silicate (umol/l): 79.016 - 138.512

Graphical representation

Depth range (m): 446 - 1538

Temperature range (°C): -1.828 - 0.688

Nitrate (umol/L): 29.325 - 33.677

Salinity (PPS): 34.495 - 34.811

Oxygen (ml/l): 4.675 - 6.648

Phosphate (umol/l): 2.137 - 2.491

Silicate (umol/l): 79.016 - 138.512
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 300 - 1250m.
From 300 to 1250 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathydraco marri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAATCTTCGGCGCTTGGGCCGGGATAGTGGGCACCGCCCTTAGCCTGCTCATTCGAGCAGAACTTAGCCAACCTGGCGCCCTATTGGGGGACGACCAAATTTATAATGTAATTGTCACCGCTCACGCTTTCGTGATAATTTTCTTTATAGTTATACCCATCATAATCGGAGGCTTTGGAAACTGGCTCATCCCGCTCATGATCGGGGCCCCCGACATAGCTTTCCCACGAATAAATAACATGAGCTTCTGACTCCTCCCTCCCTCCTTCCTCCTCTTACTAGCTTCTTCCGGCGTGGAGGCCGGGGCAGGTACCGGATGAACCGTTTACCCTCCCCTCTCTGGAAACTTAGCCCACGCAGGAGCCTCCGTTGATTTAACTATCTTTTCTCTACATTTAGCTGGCATTTCTTCTATCTTAGGCGCAATTAACTTTATCACAACAATTATTAACATGAAACCTCCCGCCATCTCTCAATACCAAACACCCCTATTCGTGTGGTCCGTCTTAATTACTGCTGTTCTTCTACTTCTCTCACTTCCTGTACTAGCTGCCGGCATCACCATGCTCCTTACGGATCGAAACCTTAATACCACCTTCTTTGACCCGGCCGGCGGAGGAGACCCCATCCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathydraco marri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!