Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Larval pelagic phase is long (Ref. 89402).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southern Ocean: circumpolar coastal Antarctic broadly to the Convergence (Ref. 11892). Endemic to the seas around Antarctica (Ref. 5179).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 25 - 27; Analsoft rays: 25 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1750 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 90825)); max. published weight: 80.0 kg (Ref. 5179); max. reported age: 39 years (Ref. 88081)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Uniformly brownish, with 4 irregular and incomplete dark cross-bars and with some dark spots (Ref. 11892).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 0 - 2200 m (Ref. 90824), usually 88 - 1600 m (Ref. 5179)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 102 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): -1 - 620
  Temperature range (°C): -1.818 - 0.917
  Nitrate (umol/L): 28.340 - 32.425
  Salinity (PPS): 34.006 - 34.693
  Oxygen (ml/l): 4.057 - 7.825
  Phosphate (umol/l): 1.916 - 2.361
  Silicate (umol/l): 48.695 - 89.154

Graphical representation

Depth range (m): -1 - 620

Temperature range (°C): -1.818 - 0.917

Nitrate (umol/L): 28.340 - 32.425

Salinity (PPS): 34.006 - 34.693

Oxygen (ml/l): 4.057 - 7.825

Phosphate (umol/l): 1.916 - 2.361

Silicate (umol/l): 48.695 - 89.154
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Based on their observations and those of other authors, Eastman & DeVries (2000) summarised the life cycle of D. mawsoni as follow: the juveniles up to 12 cm total length live in the surface waters near the continent and feed on adult euphausiids and larval fish (Pakhomov and Pankratov 1992). When specimens reaching 18 cm of total length, they descend to within 100 m of the bottom at depths of 300-500 m and assume a bentho-pelagic existence. They remain in coastal waters for several years, feeding primarily on fish (Pakhomov and Tseytlin 1992). D. mawsoni attaining sexual maturity between 90-100 cm of total length an migrate north to the oceanic waters between the shelf break and the Antarctic Polar Front. These records are based exclusively on specimens of D. mawsoni taken from the stomachs of sperm whales (Yukhov 1982). Most occurrences are 926-1111 km from the coast, about half the distance to the Polar Front, but other captures indicate that some individuals travel as far as 1666 km from the coast (Yukhov 1982). These northward migrations take place early in the austral summer. While in oceanic waters, D. mawsoni occupy the mesopelagic zone (300-600 m), with a preferred depth of 500 m, and feed on squid for a period of 1-2 years (Yukhov 1982). The same author speculated that D. mawsoni return to coastal waters for spawning several times during their life, although they may not spawn every year. In McMurdo Sound most D. mawsoni are caught from late September to early December, with set line catches peaking in October/November (DeVries 1998). The spawning of the toothfish is in late winter/early spring. During November in McMurdo Sound, D. mawsoni are feeding in the clear food-rich waters of the Southern Ross Sea, predominantly on Pleuragramma antarcticum (Eastman 1985). This period of feeding precedes both the annual plankton bloom, when visibility for location of prey is reduced, and the northward migratory phase of their life-cycle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

This species reach the highest longevity with another high-Antarctic nototheniid (Aethotaxis mitopteryx) of more than 30 years (La Mesa & Vacchi, 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

The Antarctic toothfish Dissostichus mawsoni, with maximum total length more than 170 cm, is the largest high Antarctic notothenioids. The estimated growth rate for D. mawsoni in early life is about 56 mm year-1 (La Mesa & Vacchi, 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dissostichus mawsoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCTACTTAATTTTCGGCGCCTGGGCCGGAATAGTAGGTACAGCCCTTAGCCTGCTCATCCGGGCAGAACTTAGCCAACCTGGCGCCCTATTGGGGGACGACCAAATCTATAACGTAATTGTTACCGCTCACGCCTTCGTAATAATCTTCTTTATAGTCATACCGATCATAATCGGAGGCTTCGGAAACTGACTCATCCCCCTCATGATCGGGGCCCCCGACATGGCTTTCCCTCGAATAAATAATATGAGTTTCTGGCTCCTCCCTCCCTCCTTCCTACTCTTACTAGCTTCTTCAGGTGTAGAAGCCGGGGCGGGAACCGGCTGAACTGTCTATCCCCCCCTCTCTGGAAACTTAGCCCACGCAGGTGCATCCGTTGATCTAACTATTTTCTCTCTGCATTTAGCAGGCATTTCTTCCATCTTAGGTGCAATTAATTTTATCACAACAATTATTAACATGAAACCCCCTGCCATCTCTCAATACCAAACCCCTCTGTTCGTATGGGCCGTCTTAATTACTGCCGTTCTTCTACTTCTTTCACTTCCTGTGCTAGCTGCCGGAATCACCATGCTTCTCACGGACCGTAACCTCAACACCACCTTCTTTGACCCTGCAGGAGGGGGAGACCCTATTCTTTACCAACATCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dissostichus mawsoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

The toothfish is subjected to the commercial fishing from the ?60s. The fast decreasing of the stocks carried to the control of the fishing activities by the Convention for the Conservation of the Antarctic Marine Living Resource (CCAMLR).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Antarctic toothfish

The Antarctic toothfish, Dissostichus mawsoni, is a perciform member of the suborder Notothenioidei, family Nototheniidae. It is often mistakenly referred to as an Antarctic cod, consistent with the misnaming of other notothenioid Antarctic fish as rock cods. However, notothenioid fishes are unrelated to cods, which are in another taxonomic order, the Gadiformes. The generic name Dissostichus is from the Greek dissos (twofold) and stihcus (line) and refers to the presence of two long lateral lines, which are very important to the species’ ecology. The common name toothfish refers to the presence of biserial dentition in the upper jaw, thought wrongly to give it a shark-like appearance. The habitat of the Antarctic toothfish is in sub-zero degree water below latitude 60 degrees south.

Contents

Description [edit]

Fully grown, these fish (and their warmer-water relative, the Patagonian toothfish, D. eleginoides) can grow in excess of two metres in length and 135 kg in weight, twice as large as the next largest Antarctic fish. Being large, and consistent with the unstructured food webs of the ocean (i.e., big fish eat little fish regardless of identity, even eating their own offspring), the Antarctic toothfish has been characterized as a voracious predator. Furthermore, by being by far the largest midwater fish in the Southern Ocean, it is thought to fill the ecological role that sharks play in other oceans.[1][2][3] Aiding in that role, the Antarctic toothfish is one of only five notothenioid species that, as an adult, are neutrally buoyant. This buoyancy is attained at 100–120 cm in length[4][5][6] and enables them to spend time above the bottom without expending extra energy.[7][8] Both bottom-dwelling and mid-water prey are therefore available to them. Most other notothenioid fish and the majority of all Antarctic fish, including smaller toothfish, are confined to the bottom.[3] Coloring is black to olive brown, sometimes lighter on the undersides, with a mottled pattern on body and fins. Small fish blend in very well among the benthic sponges and corals.[9] They have a broad head, an elongated body, long dorsal and anal fins, large pectoral fins and a rudder-like caudal fin. They typically move slowly but are capable of speed bursts that can elude predatory seals.[10][11] Therefore, competition for prey among toothfish and these other mesopredators (middle trophic level predators) could be very important. The large Antarctic toothfish are eaten by sperm whales Physeter macrocephalus, killer whales Orcinus orca, Weddell seals and colossal squid Mesonychoteuthis hamiltoni. Toothfish that are dwelling on the bottom, especially in ice free waters of the continental slope, eat grenadiers (Macrouridae) and skates (Raja spp.).[12] Antarctic toothfish have been caught to depths of 2200m, though based on commercial fishing effort, few occur that deep.[13]

Aging and reproduction [edit]

Aging data indicate that Antarctic toothfish are relatively fast growing when young, but then growth slows later in life. They reach about one third of maximum size after five years, and half maximum by 10 years, after which growth slows considerably.[14][15] To grow fast when small is an adaptation of most predatory fish, e.g., sharks, so as not to be small for very long. The maximum age recorded so far has been 48 years.[16] Antarctic toothfish take a long time to mature (13 years for males, 17 years for females) and once mature may not spawn every year, though the actual spawning interval is unknown.[17] Only a few Antarctic toothfish with mature eggs have ever been caught, meaning that knowledge is sparse about fecundity.[7][18] They spawn sometime during winter.[18][19] Large, mature, older fish have been caught among the seamounts of the Pacific-Antarctic Ridge, a location thus thought to be important for spawning. Smaller, subadult Antarctic toothfish tend to concentrate on the bottom hidden among sponges and corals of the continental shelf, and a large portion of the larger ones remain in the particularly food-rich waters of the continental slope.[18][19][20] This sequestering by size and age could be another adaptation for small fish to avoid being eaten by large ones. The recruitment potential of Antarctic toothfish, a measure of both fecundity and survival to spawning age, is not known.

Anatomy and physiology [edit]

Antarctic toothfish have a lightweight, partially cartilaginous skeleton, lack a swim bladder, and have fatty deposits which act as a stored energy source, particularly during spawning. This fat is also what makes large toothfish neutrally buoyant. Many toothfish caught over the seamounts are very depleted of fat, and this is thought perhaps to be related to spawning and spawning migration, which are energy demanding activities.[21] It is not known what happens to these fat-depleted fish, including whether they reach, or how long it takes them to reach, breeding condition again; this ostensibly occurs upon returning to continental slope waters. Antarctic toothfish have vision and lateral line systems well adapted to find prey in low light levels.[22] Since ice covers the surface of the ocean where Antarctic toothfish occur even in summer, these sensory specializations likely evolved to enable survival in the reduced light levels found under ice and in the Antarctic winter, as well as at deep depths. Antarctic toothfish also have a very well developed sense of smell,[22] which is why they are easily caught by baited hooks and also scavenge the remains of penguins killed by other predators.

Cold adaptation [edit]

The Antarctic toothfish is noteworthy, like most other Antarctic notothenioids, for producing antifreeze glycoproteins, a feature not seen in its closest relative the Patagonian toothfish, which typically inhabits slightly warmer waters. The presence of antifreeze glycroproteins allows the Antarctic toothfish (and other notothenioids) to thrive in sub-zero waters of the Southern Ocean surrounding Antarctica. The Antarctic toothfish’s voracious appetite also is important in coping with cold water.[23] It is mainly caught in the Ross Sea in the austral summer but has also been recorded from Antarctic coastal waters south of the Indian Ocean sector, in the vicinity of the Antarctic peninsula, and near the South Sandwich Islands.

Fishery [edit]

A fishery for Antarctic toothfish, managed by the Convention for the Conservation of Antarctic Marine Living Resources (CCAMLR), has existed since 1996. The existence of this fishery in the Ross Sea, the area where most Antarctic toothfish are caught, is very contentious owing to the lack of accurate population parameters, such as original stock size, fecundity, and recruitment. Moreover, the main fishing grounds cover the area through which the entire stock of Antarctic toothfish passes,[24] adding further challenge to management owing to the indiscriminate nature of benthic longline fishing. The bycatch of other fish can also be substantial, with the ratio to tonnes of toothfish caught ranging from 5–35%.[25] CCAMLR is allowing the original, hypothetical spawning biomass to be reduced by 50%, which is done by targeting the oldest, largest, and potentially most fecund fish in the stock. In just 15 years, the average age of fish has decreased about 10 years.[26]

Consistent with this loss of large fish, an independent study has detected the disappearance of large fish at the southern periphery of its range.[27] In accord with decreasing number and size of fish, other studies have shown that the prevalence of fish-eating killer whales has been decreasing in the southern Ross Sea, foraging efficiency of Weddell seals is decreasing, and numbers of Adélie penguins (competitors for silverfish) have been increasing.[27][28] These trends indicate the problem of managing this fishery in the best interests of the ecosystem in the face of a paucity of life history information.

The total catch of Antarctic toothfish in 2011/12 was around 3,800 tonnes. Over 3,500 tonnes of this was taken from the Ross Sea (FAO Statistical Divisions 88.1 and 88.2) with the remainder taken from other high seas areas within the CCAMLR Convention Area.[29]

Environment and bycatch [edit]

CCAMLR imposes stringent environmental protection and bycatch mitigation measures to Antarctic toothfish fisheries including:

  • Monitoring of daytime setting and movement of vessels from the fishery should any vessel catch more than three seabirds [30]
  • Use of streamer lines during setting to keep birds away from baited hooks [31]
  • Weighting of lines to ensure fast sink rates to prevent seabirds from accessing baited hooks [32]
  • The use of bird exclusion devices (BEDs) to prevent birds from accessing hooks whilst lines are being hauled [30]
  • Limitations on the release of fish offal overboard at the same time as setting and hauling of lines to avoid attracting seabirds. There is an additional requirement that prohibits the dumping of all offal south of 60°S, the region where Antarctic toothfish are caught [33]
  • Prohibition on the dumping of oil, plastic, garbage, food waste, poultry, eggs or eggshells, sewage and ash by fishing vessels [33]
  • Prohibition of the use of plastic packaging bands on fishing vessels [33]

Incidental mortality of seabirds as a result of fishing has fallen to near-zero levels in the CCAMLR Convention Area. No mortality of seabirds or marine mammals was recorded as a result of fishing for Antarctic toothfish in 2011/12 and only one seabird has been killed as a result of fishing in the Ross Sea since 1996/97.[34]

Bycatch of fish species is poorly managed in this fishery. For example, mitigation for bycatch of grenadiers (Macrourus spp.), a major prey item for toothfish,[35] is unsatisfactory, with the take and likely abundance of these fish having decreased dramatically since initiation of the toothfish fishery.[25] Similarly, moray cod (Muraenolepis evseenkoi) are caught as bycatch by the toothfish fleet at levels that may be leading to its extirpation.[36]

Compliance [edit]

Compliance measures adopted by CCAMLR apply to all Antarctic toothfish fisheries. These include:

  • At-sea inspections of fishing vessels [37]
  • Vessel licensing [38]
  • Port inspections of fishing vessels[39]
  • Continuous reporting of fishing vessel positions via satellite linked Vessel Monitoring Systems (VMS)[40]
  • Catch Documentation Scheme for Toothfish which tracks toothfish from the point of landing through to the final point of sale and requires verification and authorisation by government authorities at each step[41]

Sustainability [edit]

In November 2010, the Marine Stewardship Council certified the Ross Sea Antarctic Toothfish fishery as a sustainable and well managed fishery.[42] This, too, is contentious, with many conservation groups protesting the certification due to the paucity of information needed to reliably manage the fishery,[43] and the fact that only 6 of ~15 vessels in the fishery are certified. Moreover, MSC-certified Antarctic toothfish comprised only 1% of total toothfish caught in the Southern Ocean in 2010.[44]

The small portion of Antarctic toothfish certified, the high price that it commands (sold under its commercial name of Chilean sea bass, it fetches at least $US25 per pound at retail prices) and the remote areas where a large proportion of the fish are caught, encourages Illegal Unregulated and Unreported (IUU) fishing and mislabeling.[45][46] A recent genetic study of MSC-labeled Antarctic toothfish found in markets revealed that a significant proportion were not from the MSC-certified stock, and many were not even toothfish at all.[47] However, the claims of this study were unable to be substantiated as the data were not made available for independent examination. The MSC had conducted an earlier study using more robust methodology which found no evidence of mislabelling.[48] The MSC conducts an annual audit of the fishery which includes sampling of certified product.

Due to the intense challenges that faced toothfish management in the 1990s and early 2000s (e.g., IUU fishing, mislabelling, inadequate data for management), consumer seafood guides such as the Monterey Bay Seafood Watch placed toothfish (Chilean Seabass) on their red, or “avoid”, list.,[49] however in light of up to date, internationally peer reviewed scientific information, in April 2013, Seafood Watch upgraded the Ross Sea Antarctic toothfish fishery to a "Good Alternative".[50]

Greenpeace International also added the Antarctic toothfish to its seafood red list in 2010. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[51] This approach is at variance with the high score given the fishery when it was granted certification by the Marine Stewardship Council,[52] though the high score itself is controversial.[43]

References [edit]

  1. ^ Andriashev, A.P. (1962). On the systematic position of the giant nototheniid fish (Pisces, Nototheniidae) from the McMurdo Sound, Antarctica. Zool. Zhur. 41:1048–1050 (in Russian; English translation available from National Institute of Oceanography, Wormley, Godalming, Surrey, UK, No. NIOT/1132, June 1970).
  2. ^ DeVries, A.L.; and Eastman JT (1998) Brief review of the biology of Dissostichus mawsoni. CCAMLR Document WG-FSA-98/49, Hobart, Australia.
  3. ^ a b Eastman, J.T. (1993) Antarctic fish biology. Academic Press, San Diego.
  4. ^ Eastman, J.T.; and DeVries, A.L. (1981). Buoyancy adaptations in a swim-bladderless Antarctic fish. Journal of Morphology 167:91–102.
  5. ^ Eastman, J.T.; and DeVries, A.L. (1982). Buoyancy studies of notothenioid fishes in McMurdo Sound, Antarctica. Copeia 2:385–393.
  6. ^ Near, T.J.; Russo, S.E.; Jones, C.D.; and DeVries, A.L. (2003) Ontogenetic shift in buoyancy and habitat in the Antarctic toothfish, Dissostichus mawsoni (Perciformes: Nototheniidae). Polar Biol. 26:124–128.
  7. ^ a b Yukhov, V.L. (1971). The range of Dissostichus mawsoni Norman and some features of its biology. Journal of Ichthyology 11: 8–18.
  8. ^ Fuiman, L.A.; Davis, R.W.; and Williams, T.M. (2002). Behaviour of midwater fishes under the Antarctic ice: observations by a predator. Marine Biology 140:815–822.
  9. ^ Eastman, J.T.; and Barry, J.P. (2002) Underwater video observation of the Antarctic toothfish Dissostichus mawsoni (Perciformes: Nototheniidae) in the Ross Sea, Antarctica. Polar Biology 25: 391–395
  10. ^ Eastman, J.T. (1985) Pleuragramma antarcticum (Pisces, Nototheniidae) as food for other fishes in McMurdo Sound, Antarctica. Polar Biology 4:155–160.
  11. ^ La Mesa, M.; Eastman, J.T.; and Vacchi, M. (2004) The role of notothenioid fish in the food web of the Ross Sea shelf waters: a review. Polar Biology 27:321–338.
  12. ^ Fenaughty, J.M.; Stevens, D.W., Hanchet, S.M. (2003). Diet of the Antarctic toothfish (Dissostichus mawsoni) from the Ross Sea, Antarctica (CCAMLR Statistical Subarea 88.1). CCAMLR Sci. 10:1–11.
  13. ^ Hanchet, S.M.; Rickard, G.J.; Fenaughty, J.M.; Dunn, A.; and Williams, M.J.H. (2008). Hypothetical life cycle for Antarctic toothfish (Dissostichus mawsoni) in the Ross Sea region. CCAMLR Sci. 15:35–53.
  14. ^ Horn, P.L. (2002). Age and growth of Patagonian toothfish (Dissostichus eleginoides) and Antarctic toothfish (D. mawsoni) in waters from the New Zealand Subantarctic to the Ross Sea, Antarctica. Fish Research 56:275–287.
  15. ^ Brooks, C.M.; Andrews, A.H.; Ashford, J.R.; Ramanna, N.; Jones, C.D.; Lundstrom, C.C.; and Cailliet, G.M. (2010). Age estimation and lead–radium dating of Antarctic toothfish (Dissostichus mawsoni) in the Ross Sea. Polar Biology doi:10.1007/s00300-010-0883-z.
  16. ^ Hanchet, S.M.; Stevenson, M.L.; Phillips, N.L.; and Dunn, A. (2005) A characterisation of the toothfish fishery in Subareas 88.1 and 88.2 from 1997/98 to 2004/05. CCAMLR WG-FSA-05/29. Hobart, Australia.
  17. ^ Parker, S.J.; and Grimes, P.J. (2010). Length- and age-at-spawning of Antarctic toothfish (Dissostichus mawsoni) in the Ross Sea. CCAMLR Sci. 17: 53–73.
  18. ^ a b c Hanchet, S.M. (2010) Updated species profile for Antarctic toothfish (Dissostichus mawsoni). CCAMLR WG-FSA-10/24. Hobart, Australia.
  19. ^ a b Brooks, C.M.; Ashford, J.R. (2008) Spatial distribution and age structure of the Antarctic toothfish (Dissostichus mawsoni) in the Ross Sea, Antarctica. CCAMLR WG-FSA-08-18. Hobart, Australia.
  20. ^ Ashford, J.; Dinniman, M.; Brooks, C.; Andrews, A.H.; Hofmann, E.; Cailliet, G.; Jones, C.; and Ramanna, N. (2012). Does large-scale ocean circulation structure life history connectivity in Antarctic toothfish (Dissostichus mawsoni)? Canadian Journal of Fisheries and Aquatic Sciences 69: doi:10.1139/f2012-111.
  21. ^ Fenaughty, J.M.; Eastman, J.T.; and Sidell, B.D. (2008). Biological implications of low condition factor “axe handle” specimens of the Antarctic toothfish, Dissostichus mawsoni, from the Ross Sea. Antarctic Science 20:537–551.
  22. ^ a b Eastman,JT; Lannoo, MJ. (2011). Divergence of brain and retinal anatomy and histology in pelagic Antarctic notothenioid fishes of the sister taxa Dissostichus and Pleuragramma. Journal of Morphology 272:419-441.
  23. ^ Roberts, J.; Xavier, J.C.; and Agnew, D.L. (2011). The diet of toothfish species Dissostichus eleginoides and Dissostichus mawsoni with overlapping distributions. Journal of Fish Biology 79: 138–154.
  24. ^ Ashford, J.; Dinniman, M.; Brooks, C.; Andrews, A.H.; Hofmann, E.; Cailliet, G.; Jones, C.; and Ramanna, N. (2012). Does large-scale ocean circulation structure life history connectivity in Antarctic toothfish (Dissostichus mawsoni)? Can. J. Fish. Aquat. Sci. 69: doi:10.1139/f2012-111
  25. ^ a b Ainley, D.G.; and Pauly, D. (2012) Fishing down the foodweb of the Antarctic shelf and slope. Polar Record, in press.
  26. ^ Ainley, D.G.; Brooks, C.M.; Eastman, J.T.;, and Massaro, M. (2012). Unnatural selection of Antarctic Toothfish in the Ross Sea, Antarctica. F. Huettmann (ed.), Protection of the Three Poles, pp. 53-75. DOI 10.1007/978-4-431-54006-9_3, Springer, Tokyo.
  27. ^ a b Ainley, D.G.; Nur, N.; Eastman, J.T.; Ballard, G.; Parkinson, C.L.; Evans, C.W.; and DeVries, A.L. (2012). Decadal trends in abundance, size and condition of Antarctic toothfish in McMurdo Sound, Antarctica, 1972-2011. Fish & Fisheries, DOI: 10.1111/j.1467-2979.2012.00474.x.
  28. ^ Ainley, D.G.; Ballard, G. (2012) Trophic interactions and the decrease in Killer Whale (Orcinus orca) prevalence with reduced availability of large fish in the southern Ross Sea. Aquatic Mammals 38:153-160.
  29. ^ SC-CAMLR-XXXI, Table 1, http://www.ccamlr.org/en/sc-camlr-xxxi
  30. ^ a b CCAMLR CM 25-02, http://www.ccamlr.org/en/measure-25-02-2009
  31. ^ CCAMLR CM 25-02,http://www.ccamlr.org/en/measure-25-02-2009
  32. ^ CCAMLR CM 24-02, http://www.ccamlr.org/en/measure-24-02-2008, and CCAMLR CM 25-02, http://www.ccamlr.org/en/measure-25-02-2009
  33. ^ a b c CCAMLR CM 26-01, http://www.ccamlr.org/en/measure-26-01-2001
  34. ^ SC-CAMLR-XXXI, paragraphs 4.2-4.3, http://www.ccamlr.org/en/sc-camlr-xxxi
  35. ^ Fenaughty, J.M., D.W. Stevens and S.L. Hanchet. 2003. Diet of the Antarctic toothfish (Dissostichus mawsoni) from the Ross Sea, Antarctica, CCAMLR statistical subarea 88.1. CCAMLR Science 10: 113–123.
  36. ^ Prut’ko, V. G.; and Chmilevskii, D. A. (2011) On the Pattern of Oogenesis, Type of Spawning, and Fecundity of Moray Cod Muraenolepis evseenkoi (Muraenolepidae: Gadiformes). Journal of Ichthyology 51:404-407.
  37. ^ CCAMLR System of Inspection, http://www.ccamlr.org/en/document/publications/inspectors-manual
  38. ^ CCAMLR CM 10-02, http://www.ccamlr.org/en/measure-10-02-2011
  39. ^ CCAMLR CM 10-03, http://www.ccamlr.org/en/measure-10-03-2009
  40. ^ CCAMLR CM 10-04, http://www.ccamlr.org/en/measure-10-04-2010
  41. ^ CCAMLR CM 10-05, http://www.ccamlr.org/en/measure-10-05-2009
  42. ^ "Ross Sea Toothfish Fishery". Retrieved 26 September 2012. 
  43. ^ a b Christian, C.; Ainley, D.; Bailey, M.; Dayton, P.; Hocevar, J.; LeVine, M.; Nikoloyuk, J.; Nouvian, C.; Velarde, E.; Werner, R.; and Jacquet, J. (2012). Questionable stewardship: A review of formal objections to MSC fisheries certifications. Biological Conservation, in press.
  44. ^ CCAMLR (2012). Statistical Bulletin, Vol. 24. Hobart, Australia.
  45. ^ Knecht, G.B. (2006). Hooked: Pirates, Poaching and the Perfect Fish. Rodale, Inc.
  46. ^ Knecht, G.B. (2007). A politically incorrect fish makes a comeback. Wall Street Journal, Saturday/Sunday January 27/28 2007.
  47. ^ Marko, P.B.; Nance, H.A.; and Guynn, K.D. (2011) Genetic detection of mislabeled fish from a certified sustainable fishery. Current Biology 21: R621-R622.
  48. ^ http://www.msc.org/newsroom/news/update-lack-of-evidence-blocks-msc-investigation-into-toothfish-mislabelling-claims
  49. ^ Seafood Watch (2012). http://www.montereybayaquarium.org/cr/cr_seafoodwatch/sfw_recommendations.aspx?c=ln
  50. ^ "Chilean Seabass Seafood Watch Report". April 2013. Retrieved 19 April 2013. 
  51. ^ This assessment is contentious. Greenpeace International Seafood Red list
  52. ^ http://www.msc.org/track-a-fishery/certified/southern-ocean/ross-sea-toothfish-longline

Further references [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!