Overview

Comprehensive Description

Biology

High-oceanic and mesopelagic; found in the upper 100 m at night (Ref. 4066). Possibly fed on by Champsocephalus gunnari.
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Generally, circumglobal between 36°S and 51°S. Southern Ocean: 57°58'S, 50°00'W in Atlantic Ocean sector and from 54°29'S, 74°00'E and 48°43'S, 70°58'E in Indian Ocean sector.
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmopolitan in Southern Hemisphere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 22 - 25
  • Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 95 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.5 cm SL (male/unsexed; (Ref. 5182))
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; oceanodromous (Ref. 51243); marine
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 2275
  Temperature range (°C): 0.268 - 9.673
  Nitrate (umol/L): 12.734 - 35.640
  Salinity (PPS): 33.830 - 34.816
  Oxygen (ml/l): 4.583 - 7.789
  Phosphate (umol/l): 1.074 - 2.347
  Silicate (umol/l): 4.639 - 84.061

Graphical representation

Depth range (m): 0 - 2275

Temperature range (°C): 0.268 - 9.673

Nitrate (umol/L): 12.734 - 35.640

Salinity (PPS): 33.830 - 34.816

Oxygen (ml/l): 4.583 - 7.789

Phosphate (umol/l): 1.074 - 2.347

Silicate (umol/l): 4.639 - 84.061
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

High-oceanic and mesopelagic; found in the upper 100 m at night (Ref. 4066). Possibly fed on by Champsocephalus gunnari (Ref. 5182).
  • Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Protomyctophum choriodon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAATCTTCGGTGCCTGAGCAGGCATAGTAGGAACCGCTCTTAGCCTCCTAATTCGAGCTGAACTCAGCCAACCTGGGGCCCTCCTGGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCATGCCTTTGTAATAATTTTCTTTATGGTTATACCTATCATAATTGGAGGATTCGGAAACTGATTAATCCCCCTAATGATCGGAGCCCCCGATATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTCCTCCTTTTAGCCTCCTCCGGCGTAGAAGCCGGGGCCGGAACCGGCTGAACAGTCTACCCGCCTCTTGCCGGAAACCTCGCCCACGCCGGAGCATCTGTTGATTTAACAATCTTTTCCCTTCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCAATTAATTTTATTACAACCATTATTAATATAAAGCCTCCTGCAATCTCCCAATACCAAACCCCTTTATTTGTATGAGCCGTCCTCATTACAGCAGTACTTCTCCTCCTGTCACTCCCAGTACTAGCTGCCGGCATCACAATGCTCTTAACAGACCGAAATCTAAACACCACCTTCTTCGACCCCTCCGGCGGAGGAGACCCAATCCTTTACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Protomyctophum choriodon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!