Overview

Comprehensive Description

Biology

High-oceanic and mesopelagic; found in the upper 100 m at night (Ref. 4066). Possibly fed on by Champsocephalus gunnari.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Generally, circumglobal between 36°S and 51°S. Southern Ocean: 57°58'S, 50°00'W in Atlantic Ocean sector and from 54°29'S, 74°00'E and 48°43'S, 70°58'E in Indian Ocean sector.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmopolitan in Southern Hemisphere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 22 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 95 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.5 cm SL (male/unsexed; (Ref. 5182))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; oceanodromous (Ref. 51243); marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 2275
  Temperature range (°C): 0.268 - 9.673
  Nitrate (umol/L): 12.734 - 35.640
  Salinity (PPS): 33.830 - 34.816
  Oxygen (ml/l): 4.583 - 7.789
  Phosphate (umol/l): 1.074 - 2.347
  Silicate (umol/l): 4.639 - 84.061

Graphical representation

Depth range (m): 0 - 2275

Temperature range (°C): 0.268 - 9.673

Nitrate (umol/L): 12.734 - 35.640

Salinity (PPS): 33.830 - 34.816

Oxygen (ml/l): 4.583 - 7.789

Phosphate (umol/l): 1.074 - 2.347

Silicate (umol/l): 4.639 - 84.061
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

High-oceanic and mesopelagic; found in the upper 100 m at night (Ref. 4066). Possibly fed on by Champsocephalus gunnari (Ref. 5182).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Protomyctophum choriodon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAATCTTCGGTGCCTGAGCAGGCATAGTAGGAACCGCTCTTAGCCTCCTAATTCGAGCTGAACTCAGCCAACCTGGGGCCCTCCTGGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCATGCCTTTGTAATAATTTTCTTTATGGTTATACCTATCATAATTGGAGGATTCGGAAACTGATTAATCCCCCTAATGATCGGAGCCCCCGATATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTCCTCCTTTTAGCCTCCTCCGGCGTAGAAGCCGGGGCCGGAACCGGCTGAACAGTCTACCCGCCTCTTGCCGGAAACCTCGCCCACGCCGGAGCATCTGTTGATTTAACAATCTTTTCCCTTCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCAATTAATTTTATTACAACCATTATTAATATAAAGCCTCCTGCAATCTCCCAATACCAAACCCCTTTATTTGTATGAGCCGTCCTCATTACAGCAGTACTTCTCCTCCTGTCACTCCCAGTACTAGCTGCCGGCATCACAATGCTCTTAACAGACCGAAATCTAAACACCACCTTCTTCGACCCCTCCGGCGGAGGAGACCCAATCCTTTACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Protomyctophum choriodon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!