Overview
Comprehensive Description
Biology
Oceanic and mesopelagic (Ref. 4066, 75154). Found mainly below 800 m with shallowest depth of capture 328 m.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
Trusted
Distribution
Circumglobal between the Subtropical Convergence and the Antarctic Polar Front. Known from about 50°S to 54°S along 40°W, and between the Subtropical Convergence and the Antarctic Polar Front at about 124°W.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
Trusted
New Zealand Exclusive Economic Zone
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 17 - 19; Analspines: 0; Analsoft rays: 17 - 20
-
Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
http://www.fishbase.org/references/FBRefSummary.php?id=4066&speccode=10238
Trusted
Size
Max. size
14.0 cm SL (male/unsexed; (Ref. 5182))
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
Trusted
Ecology
Habitat
Environment
bathypelagic; oceanodromous (Ref. 51243); marine; depth range 2200 - 2350 m (Ref. 58018)
-
Bogutskaya, N.G. 2007 Preliminary assignment of coordinates to type localities in the Catalog of Fishes. Unpublished dbf file. (Ref. 58018)
http://www.fishbase.org/references/FBRefSummary.php?id=58018&speccode=6010
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.
Environmental ranges
Depth range (m): 0 - 2325
Temperature range (°C): 0.679 - 9.851
Nitrate (umol/L): 12.958 - 35.884
Salinity (PPS): 33.795 - 34.800
Oxygen (ml/l): 3.969 - 7.704
Phosphate (umol/l): 1.061 - 2.438
Silicate (umol/l): 4.661 - 120.378
Graphical representation
Depth range (m): 0 - 2325
Temperature range (°C): 0.679 - 9.851
Nitrate (umol/L): 12.958 - 35.884
Salinity (PPS): 33.795 - 34.800
Oxygen (ml/l): 3.969 - 7.704
Phosphate (umol/l): 1.061 - 2.438
Silicate (umol/l): 4.661 - 120.378
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 15 samples.
Environmental ranges
Depth range (m): 0 - 2325
Temperature range (°C): 0.679 - 9.851
Nitrate (umol/L): 12.958 - 35.884
Salinity (PPS): 33.795 - 34.800
Oxygen (ml/l): 3.969 - 7.704
Phosphate (umol/l): 1.061 - 2.438
Silicate (umol/l): 4.661 - 120.378
Graphical representation
Depth range (m): 0 - 2325
Temperature range (°C): 0.679 - 9.851
Nitrate (umol/L): 12.958 - 35.884
Salinity (PPS): 33.795 - 34.800
Oxygen (ml/l): 3.969 - 7.704
Phosphate (umol/l): 1.061 - 2.438
Silicate (umol/l): 4.661 - 120.378
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gymnoscopelus hintonoides
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 12 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 12 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTGGTATTCGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTCCTCATTCGAGCTGAACTTAGCCAACCTGGAGCCCTTCTCGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCACGCCTTCGTAATAATCTTCTTTATGGTAATGCCCATCATGATCGGTGGATTTGGCAACTGACTAATTCCCCTAATGATTGGAGCCCCCGATATGGCATTCCCACGAATGAATAATATGAGCTTCTGGCTCCTCCCTCCCTCTTTCCTTCTCCTCCTGGCCTCCTCCGGAGTAGAGGCTGGGGCTGGTACTGGTTGAACTGTTTATCCGCCACTTGCTGGCAACCTTGCACACGCTGGGGCTTCCGTAGACCTAACGATTTTCTCGCTTCACCTAGCGGGGGTCTCTTCAATTCTGGGAGCAATCAACTTTATTACGACCATCATTAATATGAAGCCCCCTGCAGTTACTCAGTACCAAACCCCATTATTCGTCTGGGCAGTATTAATTACAGCTGTACTCCTTCTACTTTCCCTTCCTGTTCTGGCTGCCGGCATCACCATACTTCTAACCGACCGTAATTTAAATACTACCTTCTTCGACCCTGCGGGAGGAGGGGACCCCATCCTTTACCAGCACTTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Gymnoscopelus hintonoides
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


