Overview

Comprehensive Description

Biology

Oceanic and mesopelagic (Ref. 4066, 75154). Found mainly below 800 m with shallowest depth of capture 328 m.
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Circumglobal between the Subtropical Convergence and the Antarctic Polar Front. Known from about 50°S to 54°S along 40°W, and between the Subtropical Convergence and the Antarctic Polar Front at about 124°W.
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern circumglobal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 17 - 19; Analspines: 0; Analsoft rays: 17 - 20
  • Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

14.0 cm SL (male/unsexed; (Ref. 5182))
  • Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 2200 - 2350 m (Ref. 58018)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Bogutskaya, N.G. 2007 Preliminary assignment of coordinates to type localities in the Catalog of Fishes. Unpublished dbf file. (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0 - 2325
  Temperature range (°C): 0.679 - 9.851
  Nitrate (umol/L): 12.958 - 35.884
  Salinity (PPS): 33.795 - 34.800
  Oxygen (ml/l): 3.969 - 7.704
  Phosphate (umol/l): 1.061 - 2.438
  Silicate (umol/l): 4.661 - 120.378

Graphical representation

Depth range (m): 0 - 2325

Temperature range (°C): 0.679 - 9.851

Nitrate (umol/L): 12.958 - 35.884

Salinity (PPS): 33.795 - 34.800

Oxygen (ml/l): 3.969 - 7.704

Phosphate (umol/l): 1.061 - 2.438

Silicate (umol/l): 4.661 - 120.378
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnoscopelus hintonoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTGGTATTCGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTCCTCATTCGAGCTGAACTTAGCCAACCTGGAGCCCTTCTCGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCACGCCTTCGTAATAATCTTCTTTATGGTAATGCCCATCATGATCGGTGGATTTGGCAACTGACTAATTCCCCTAATGATTGGAGCCCCCGATATGGCATTCCCACGAATGAATAATATGAGCTTCTGGCTCCTCCCTCCCTCTTTCCTTCTCCTCCTGGCCTCCTCCGGAGTAGAGGCTGGGGCTGGTACTGGTTGAACTGTTTATCCGCCACTTGCTGGCAACCTTGCACACGCTGGGGCTTCCGTAGACCTAACGATTTTCTCGCTTCACCTAGCGGGGGTCTCTTCAATTCTGGGAGCAATCAACTTTATTACGACCATCATTAATATGAAGCCCCCTGCAGTTACTCAGTACCAAACCCCATTATTCGTCTGGGCAGTATTAATTACAGCTGTACTCCTTCTACTTTCCCTTCCTGTTCTGGCTGCCGGCATCACCATACTTCTAACCGACCGTAATTTAAATACTACCTTCTTCGACCCTGCGGGAGGAGGGGACCCCATCCTTTACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnoscopelus hintonoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!