Overview

Comprehensive Description

Biology

Oceanic and mesopelagic (Ref. 4066, 75154). Found mainly below 800 m with shallowest depth of capture 328 m.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal between the Subtropical Convergence and the Antarctic Polar Front. Known from about 50°S to 54°S along 40°W, and between the Subtropical Convergence and the Antarctic Polar Front at about 124°W.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern circumglobal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 17 - 19; Analspines: 0; Analsoft rays: 17 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

14.0 cm SL (male/unsexed; (Ref. 5182))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 2200 - 2350 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0 - 2325
  Temperature range (°C): 0.679 - 9.851
  Nitrate (umol/L): 12.958 - 35.884
  Salinity (PPS): 33.795 - 34.800
  Oxygen (ml/l): 3.969 - 7.704
  Phosphate (umol/l): 1.061 - 2.438
  Silicate (umol/l): 4.661 - 120.378

Graphical representation

Depth range (m): 0 - 2325

Temperature range (°C): 0.679 - 9.851

Nitrate (umol/L): 12.958 - 35.884

Salinity (PPS): 33.795 - 34.800

Oxygen (ml/l): 3.969 - 7.704

Phosphate (umol/l): 1.061 - 2.438

Silicate (umol/l): 4.661 - 120.378
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnoscopelus hintonoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTGGTATTCGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTCCTCATTCGAGCTGAACTTAGCCAACCTGGAGCCCTTCTCGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCACGCCTTCGTAATAATCTTCTTTATGGTAATGCCCATCATGATCGGTGGATTTGGCAACTGACTAATTCCCCTAATGATTGGAGCCCCCGATATGGCATTCCCACGAATGAATAATATGAGCTTCTGGCTCCTCCCTCCCTCTTTCCTTCTCCTCCTGGCCTCCTCCGGAGTAGAGGCTGGGGCTGGTACTGGTTGAACTGTTTATCCGCCACTTGCTGGCAACCTTGCACACGCTGGGGCTTCCGTAGACCTAACGATTTTCTCGCTTCACCTAGCGGGGGTCTCTTCAATTCTGGGAGCAATCAACTTTATTACGACCATCATTAATATGAAGCCCCCTGCAGTTACTCAGTACCAAACCCCATTATTCGTCTGGGCAGTATTAATTACAGCTGTACTCCTTCTACTTTCCCTTCCTGTTCTGGCTGCCGGCATCACCATACTTCTAACCGACCGTAATTTAAATACTACCTTCTTCGACCCTGCGGGAGGAGGGGACCCCATCCTTTACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnoscopelus hintonoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!