Overview

Comprehensive Description

Biology

Inhabits shallow coastal habitats and offshore reefs (Ref. 6871). Nocturnal (Ref. 6871). Probably oviparous (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Indian Ocean: confined to Western Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Aulohalaelurus labiosus is an endemic to Western Australia, from the Recherche Archipelago to the Houtman Abrolhos (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australia: Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

67 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Aulohalaelurus labiosus common endemic inshore catshark on the temperate Western Australian continental shelf, found in shallow coastal habitats and on offshore reefs at a depth of least 4 m (Last and Stevens 1994).

The biology of A. labiosus is virtually unknown. Oviparous, and attains at least 67 cm total length (TL), with adult males mature at approximately 54 cm and attaining at least 61 cm (Last and Stevens 1994, W. White, unpubl. data). There is no published information on the age and growth or diets of this species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aulohalaelurus labiosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGAGCAGGAATAGTTGGGACAGCCCTAAGTCTGCTTATTCGTGCAGAACTCGGCCAACCCGGATCACTTCTAGGAGATGATCAGATTTATAATGTGATTGTAACTGCTCACGCCTTCGTAATAATTTTCTTCATGGTAATGCCAATAATAATTGGTGGCTTTGGTAATTGATTGGTGCCTCTTATAATTGGCGCCCCGGATATGGCCTTCCCTCGTATAAATAATATAAGCTTTTGACTTCTCCCGCCATCTTTTCTTCTTCTATTAGCCTCAGCTGGAGTCGAAGCAGGAGCAGGAACAGGTTGAACAGTTTATCCCCCCTTAGCGGGCAACTTGGCACACGCCGGACCATCTGTTGATTTAACTATTTTTTCCCTACATCTAGCCGGAATTTCATCAATTCTGGCTTCAATCAACTTTATTACAACTATTATTAACATGAAACCCCCAGCTATCTCTCAATACCAAACCCCCCTATTTGTCTGATCAATTCTTGTAACTACTGTTCTTCTCCTTTTAGCTCTTCCAGTGCTTGCAGCTGGAATTACCATGCTGTTAACAGATCGAAACCTTAATACCACATTCTTTGATCCTGCTGGGGGCGGCGACCCCATCCTTTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aulohalaelurus labiosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Lisney, T.J. & White, W.T. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Justification
The biology of this endemic species is poorly known but it is reported to be common. Although it has a limited distribution in southwestern Australian coastal waters, it is not subjected to any significant fishing pressure due to its reef-dwelling habit and is of no commercial value to fisheries (although there is evidence that this catshark enters the marine aquarium trade).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no information on population size, but the species is apparently common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There is very little fishing pressure within the habitat range of this species in southwestern Australia and is also of little or no commercial value. There is evidence that this small, attractively spotted catshark enters the marine aquarium trade with several having been observed in aquarium retailers in Western Australia and it is possible that this may extend to elsewhere (Compagno, in prep., W. White, personal observation).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Species composition data from fisheries and from collectors for the aquarium trade in southwestern Australia are required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Australian blackspotted catshark

The Australian blackspotted catshark, Aulohalaelurus labiosus, is a catshark of the family Scyliorhinidae in the order Carcharhiniformes, endemic to Western Australia in the eastern Indian Ocean between latitudes 28° S and 36° S. Its length is up to 67 cm.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!