Overview

Comprehensive Description

Biology

Biology unknown.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is located off the southern coast of South America, from southern Brazil (Rio Grande do Sul) to southern Chile (Golfo de Corcovado, Chiloé Island), including Tierra del Fuego and Strait of Magellan (Mincarone and Soto 2001). It was also reported from the South Shetland Islands based on a single 230 mm specimen (Norman 1937, Hureau and Fischer 1985, Fernholm 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Straits of Magellan; Tierra del Fuego; southern Coast of Chile and Argentina; southern Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Ocean: Tierra del Fuego and southern coasts of Chile and Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Myxine australis
Catalog Number: USNM 153595
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Straits of Magellan: Sandy Point, Argentina, Atlantic
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is usually taken on muddy bottoms in shallow coastal waters at depths from 4-146 m. The Brazilian record is based on only two females, 250-292 mm, taken on the continental shelf at 30-45m depth (Mincarone and Soto 2001, Mincarone 2003). Of 86 specimens examined by Wisner and McMillan (1995), 71 (82%) were female, 12 (14%) male, and three (4%) hermaphroditic. Numbers and sizes of large eggs range from 9 (24 x 8 mm) in a female of 330 mm to 16 (21 x 7 mm) in one of 345 mm.

The biology of this species is unknown and its copulatory organ is absent. The gonads of hagfishes are situated in the peritoneal cavity. The ovary is found in the anterior portion of the gonad, and the testis is found in the posterior part. The animal becomes female if the cranial part of the gonad develops or male if the caudal part undergoes differentiation. If none develops, then the animal becomes sterile. If both anterior and posterior parts develop, then the animal becomes a functional hermaphrodite. However, hermaphroditism being characterised as functional needs to be validated by more reproduction studies (Patzner 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 100m.
From 10 to 100 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; non-migratory; marine; depth range 10 - 100 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Captured and trawled on soft mud bottom (Ref. 56499).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Copulatory organ absent. The gonads of hagfishes are situated in the peritoneal cavity. The ovary is found in the anterior portion of the gonad, and the testis is found in the posterior part. The animal becomes female if the cranial part of the gonad develops or male if the caudal part undergoes differentiation. If none develops, then the animal becomes sterile. If both anterior and posterior parts develop, then the animal becomes a functional hermaphrodite. However, hermaphroditism being characterised as functional needs to be validated by more reproduction studies (Ref. 51361 ).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myxine australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACCTTATTTTTGGAGCCTGAGCCGGAATAATTGGTACAGCTCTTAGTGTAATTATTCGAACAGAGTTAAGCCAGCCAGGATCCTTAATCAATAATGACCAAATCTATAACACAATTATCACAGCCCACGCATTTGTAATAATCTTTTTTATAGTAATACCTGTCATAATCGGAGGTTTTGGAAACTGGTTAGTCCCAATAATAATTGGTGCCCCTGATATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTTCTCCCCCCATCACTTATACTATTACTCTCCTCCTCACTAGTAAGTTCCGGGGCAGGAACTGGATGAACAGTTTATCCTCCCCTCTCTAATCACATTTCTCACATAGGCCCTTCAGTAGACCTAGCTATTTTCTCCCTTCATCTAGCAGGAGTCTCTTCAATCTTAGGGGCAATCAACTTTATCACAACAATTATTAACATAAAAACACGGTCTATAGAAATATACCATATTCCACTATTTGTATGATCAATTTTAATCACCGCAATTCTACTTCTTTTATCCTTGCCTGTTCTAGCCGCAGCTATCACTATACTCCTTACAGACCGTAATCTCAACACCACTTTCTTCGATCCTTCGGGCGGGGGAGATCCCATCCTCTATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myxine australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Mincarone, M.M.

Reviewer/s
Polidoro, B., Knapp, L. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and common. Although this species is likely impacted by shallow-water bottom trawling within at least parts of its range, there is no indication of widespread population decline. Globally it is listed as Least Concern.

Only two specimens have been collected from Brazil, and bottom trawling is occurring throughout this species known depth and distribution range. However, more information is needed to determine this species distribution, population status, and impact of trawling within Brazil. In Brazil it therefore has a regional assessment of Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is known to be common, particularly along the coast of Argentina. However there are no data to interpret population levels and rates of decline.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species' distribution and habitat overlaps with an area that is extensively impacted by trawl fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures in place, but more research is needed on this species' biology, population size, distribution and impact of fisheries activities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Southern hagfish

The Southern hagfish (Myxine australis) is a hagfish of the genus Myxine.

Description

It is a harmless scaleless, eel-like animal with a pinkish body, a whitish head and a whitish mid dorsal stripe. The size of captured specimens ranges between 91 and 394 mm.

The Southern hagfish is found in the cold waters of the Southwestern Atlantic Ocean from the coasts off Southwestern Brazil down to the Southern Ocean and the Tierra del Fuego and the Patagonian coasts of Chile and Argentina, including the Strait of Magellan. [1]

It lives hidden in the mud in relatively shallow water, between 10 and 100 metres. Its life cycle is unknown.[2]

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!