Overview

Comprehensive Description

Labrus mixtus ZBK Linnaeus, 1758

Aegean Sea : 18700-577 (1 spc.), May 2001 , Bozcaada Island , trawl , 67 m, L. Eryilmaz .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 48-48, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Adults are found in the algal zone of rocky shores (Ref. 35388). Usually solitary or in pairs with young. Females lay about 1,000 eggs in a nest of algae; the nest is guarded by the male (Ref. 35388). Feed mainly on crustaceans but also fishes and mollusks (Ref. 4742) and worms (Ref. 35388). Oviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 A slim-line wrasse with a narrow long head and a pointed snout. The colouration of Labrus mixtus is different between the sexes and very variable. The female is rose-pink to orange-red in colour with 2-3 dark spots interspersed with white on the rear dorsal and adjacent tail fin. Young males are similar in colour to the female but lack the dorsal spots. Older males have dark blue heads with brilliant blue lines and blotches that extend along the flanks. The rest of the body and the fins are bright orange and the fins also have bright blue markings. Males can reach up to 35 cm in length and the females are generally slightly smaller.The goldsinny wrasse, Ctenolabrus rupestris, is similar to the female cuckoo wrasse but lacks the three dark spots at the base of the dorsal fin and has a dark spot at the base of the tail fin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Members of the wrasse family have scaly bodies, long dorsal fins and robust, flattened teeth. The cuckoo wrasse is one of the most colourful fish that occurs in the seas around Britain and Ireland. It has a slender body and head and reaches a maximum length of 35cm. The female is rose-red to orange-red in colour with three or four black blotches interspersed by white blotches on the back, behind the dorsal fin. The male has brilliant iridescent blue on its head and blue lines and blotches along the body. Like many other wrasse species, the older females can change sex to become males with the characteristic iridescent blue coloration. The distinctive colour of this species readily distinguishes it from other wrasse species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

In the eastern Atlantic, this species is present from Norway southwards to Senegal, including the United Kingdom, Ireland, Azores, Madeira and the Canary Islands (D. Pollard pers. comm. 2008).

In the Mediterranean Sea, it is widespread in the northern and western Mediterranean and common in Cyprus, but absent from the south-eastern Levant, including Israel (Golani et al. 2006), Lebanon and Syria (D. Pollard pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Norway south to Senegal, Azores and Madeira. Also in the Mediterranean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Baltic Sea, North Sea, Mediterranean Sea, eastern Atlantic: Norway to Senegal, including Azores and Madeira.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is widespread all around Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

40.0 cm SL (male/unsexed; (Ref. 3397)); 30 cm TL (female); max. reported age: 20 years (Ref. 35388)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is mainly associated with coralligenous habitats, and particularly gorgonians. In the Azores (and probably in other Macaronesian islands), adults live bellow 50 m depth, only juveniles being sporadically found in shallower waters (P. Afonso pers. comm. 2008). It is usually either solitary or found living in pairs in the case of younger individuals in the Mediterranean and also in the Azoreas (P. Afonso, pers. comm. 2008).

It mainly feeds on crustaceans, but may also consume small fishes and molluscs (Quignard and Pras 1986).

It is a protogynous hermaphrodite, and sex reversal is completed in seven months (Sadovy and Shapiro 1987, Lönnberg and Gustafson 1937). It displays marked sexual colour dimorphism, and in the breeding season builds nests of seaweed (Golani et al. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 2 - 200 m (Ref. 5292), usually 40 - 80 m (Ref. 4742)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 256 specimens in 1 taxon.
Water temperature and chemistry ranges based on 94 samples.

Environmental ranges
  Depth range (m): 0 - 163
  Temperature range (°C): 9.707 - 12.243
  Nitrate (umol/L): 3.265 - 11.122
  Salinity (PPS): 34.432 - 35.570
  Oxygen (ml/l): 5.443 - 6.346
  Phosphate (umol/l): 0.316 - 0.723
  Silicate (umol/l): 1.843 - 5.880

Graphical representation

Depth range (m): 0 - 163

Temperature range (°C): 9.707 - 12.243

Nitrate (umol/L): 3.265 - 11.122

Salinity (PPS): 34.432 - 35.570

Oxygen (ml/l): 5.443 - 6.346

Phosphate (umol/l): 0.316 - 0.723

Silicate (umol/l): 1.843 - 5.880
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Over rocks and hard ground, and in the algal zone, between 2 - 200 m but mainly between 20 - 80 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cuckoo wrasse are mainly found in rocky areas at depths below 10m. They feed on small crustaceans, worms and molluscs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Littoral from 2 - 200 m, mainly 40 - 80 m. Usually solitary or in pairs with young. Nest of algae in seaweed. Feeds mainly on crustaceans but also fishes and molluscs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Males build dish shaped nests and guard the eggs (Ref. 205). Sex reversal is completed in 7 months (Ref. 34185, 34259).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labrus mixtus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGCCCTCCTCGGAGATGACCAAATTTATAACGTAATCGTTACAGCACATGCGTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGGGGTTTCGGAAACTGACTTATCCCACTGATAATCGGAGCTCCTGATATGGCCTTCCCTCGGATAAACAACATGAGCTTCTGGCTCCTCCCTCCCTCTTTCCTCCTCCTCCTCGCTTCTTCTGGGGTAGAAGCCGGTGCCGGCACCGGGTGAACAGTGTATCCCCCCTTAGCTGGAAACCTAGCCCACGCAGGAGCATCCGTCGATCTTACCATCTTTTCTTTACACTTAGCTGGTATTTCTTCAATTCTAGGGGCTATCAATTTTATTACAACCATCGTTAACATGAAACCCCCTGCCATCTCACAGTACCAAACCCCCCTGTTTGTATGATCCGTTCTAATTACCGCTGTCCTTCTCCTACTTTCGCTACCAGTTCTTGCAGCTGGTATTACAATGCTCCTTACAGATCGCAACCTCAATACCACCTTCTTTGATCCTGCAGGGGGCGGAGATCCTATTCTGTACCAGCACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labrus mixtus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pollard, D. & Afonso, P.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is present throughout most of the Mediterranean and in the eastern Atlantic. In the shallower parts of its distribution, habitat degradation is a concern. There is no specific population information for this species, although its population is thought to be stable. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is widespread in the Mediterranean Sea. The population is stable in Turkey (Bilecenoglu pers. comm. 2008).

It is frequent but very minor catches in the Azores indicate that this species occurs in low numbers but is widespread and probably stable in its preferred habitat (P. Afonso pers. comm. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The greatest threat to this species is habitat degradation due to eutrophication. Other lesser threats to its habitat are boat anchoring, bottom gear and diving activities that may destroy gorgonian corals. Habitat degradation is primarily a threat in the shallower areas of the distribution of this species (D. Pollard pers. comm. 2008).

The larger individuals of this species may be caught and used as a food fish in the Mediterranean Sea and the Macaronesian islands. It is commonly caught in trammel nets in Cyprus (Golani et al. 2006). In spite of the reduced catches, this may present a threat in the future given the intrinsic factors such as the low density and the sexuality of the species (P. Afonso pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range. Recommended conservation measures include regulation of human activites in areas of coralligenous habitats and the further inclusion of these habitats in Marine Protected Areas (D. Pollard pers comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cuckoo wrasse

The cuckoo wrasse, Labrus mixtus, is a species of wrasse native to the eastern Atlantic Ocean from Norway to Senegal, including the Azores and Madeira. It is also found in the Mediterranean Sea. They can be found amongst the algae on rocky shores at depths from 2 to 200 m (6.6 to 660 ft), though mostly between 40 and 80 m (130 and 260 ft). This species is an important food fish for local populations and is also popular as a game fish. It is also a popular fish for display in public aquaria.[2]

Description[edit]

This species is sexually dimorphic. The male normally has a blue head with a blue body and orange pattern and blue tail. During the breeding season. the body colouration gradually changes to an orange head and body with a blue pattern that may be more pronounced at the head. The male can reach 40 cm (16 in) in standard length. The female, however, has an orange head, body, and tail with a black stripe on the dorsal fin broken up by a number of white spots. Females can grow to 30 cm (12 in) in total length.

The female has the ability to change sex when no males are present in the area.

Etymology[edit]

The name cuckoo wrasse comes from Cornish fishermen who associated the blue markings with bluebell flowers. In the Cornish language, a bluebell is bleujenn an gog, literally "the cuckoo flower".[3]

References[edit]

  1. ^ Pollard, D. & Afonso, P. 2010. Labrus mixtus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Labrus mixtus" in FishBase. August 2013 version.
  3. ^ Zeitschrift für Anglistik und Amerikanistik, Volume 13, VEB Verlag Enzyklopädie, 1965

Additional images[edit]

Click on images for higher resolution

Cuckoo Wrasse Female 1.jpg

Female cuckoo wrasse

Cuckoo Wrasse Male 1.jpg

Male in late summer

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!