Overview

Comprehensive Description

Description: Body relatively thin, long and wide with a large eye and a terminal, pointed, small mouth. Pectoral fins medium length. Pelvic fins short. Dorsal and anal-fin bases relatively long, caudal peduncle short and wide.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults inhabit rocky or coral reefs (Ref. 9710). Feed on brittle stars, crustaceans, mollusks, and sea urchins (Ref. 9710). Juveniles actively pick parasites from larger fishes (Ref. 5521). A protogynous hermaphrodite (Ref. ). Oviparous, distinct pairing during breeding (Ref. 205). May hybridize with spotfin hogfish, B. pulchellus (Ref. 40096). Marketed fresh (Ref. 3726). Maximum depth reported from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in tropical shallow waters of the western Atlantic from Bermuda and southern Florida (USA) to the state of Sao Paulo in southern Brazil (Gomon 2006). The extent of occurrence is estimated to be 26,970 km2 based on area of coral reefs in the Caribbean and the east coast of Brazil, which is highly likely to be an overestimation due to the patchiness of the Spanish Hogfish’s distribution.

There is one doubtful record of B. rufus in St. Helena (Central South Atlantic) dating back to 1965 (Institute of Marine and Coastal Sciences accessed 2008), probably based on a misidentification.

Its extent of occurrence is estimated to be 26,960 km2 based on the area of coral reefs in the western Atlantic region (25,960 km2 in the Carribean (Burke and Maiden 2004), and 1,000 km2 in the Southern Atlantic (Spalding and Grenfel 1997). This is based on the assumption that the species is present on all reefs in the Caribbean and the east coast of Brazil, it is highly likely to be an overestimation since distribution of local population density is uneven and not all areas may be habited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda, southern Florida (USA) and throughout the Gulf of Mexico and Caribbean Sea to southern Brazil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Southern Florida (U. S. A.) and Bermuda south to São Paulo (Brazil).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9 - 11; Analspines: 3; Analsoft rays: 11 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 9626)); max. published weight: 1,020 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: The fin-ray count of D-XII,10 A-III,12 and Pect-16 indicates Bodianus. Clepticus parrae shares the median-fin ray count but has one more pectoral-fin ray and a different body shape. The two Caribbean Bodianus spp. share their fin-ray counts, but B. rufus is far more common than the deep-water species B. pulchellus (although the latter cannot be excluded for the pre-transitional larval stages). B. rufus larvae develop into a bicolored recruit with the anterior lower-half dark blue and the rear and upper-half yellow (in contrast to adults where it switches to the anterior upper-half blue). Recruits of B. pulchellus are uniformly yellow. (U)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Head, upper front part of body, and front of dorsal fin blue if from shallow water, red if from deep; rest of body and tail yellow. Dorsal, anal, and pelvic fins mostly blue or red-yellow at rear (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Analogues: Larval Thalassoma bifasciatum can appear similar but have a narrower body, smaller eye, and the dorsal-fin origin is distinctly forward on the body.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A moderately large species, to about 300 mm SL. Bodianus rufus is commonly found near coral cover, but also occurs on rock reefs, algal covered reefs and seagrass meadows (Gardiner and Harborne 2000). Demersal, lives in close association with the reef substratum (Floeter et al. 2004) and inhabits inshore, midshore and offshore areas (Ferro 2005), usually at depths of 1-6m, but sometimes as deep as 30m (Gomon 2006). Diurnal (Reebs 2002) and relatively sedentary (Floeter et al. 2004).

Juveniles displayed a certain amount of habitat specificity during a regional study in Panama, and were found exclusively around large coral heads (such as Monastrea cavernosa) located at the offshore end of coral structure (Sponaugle and Cowen 1997). Juvenile density is suggested to have a positive relationship with mean depth and the percentage of algal turf cover (Sponaugle and Cowen 1997). However, this is only verified in one study. Bodianus rufus is able to delay metamorphosis but usually settle at relatively smaller sizes (8-10mm SL) during the minimum amplitude tides of the third-quarter moon and second minimum amplitude tide, which may be linked to currents as they are weak swimmers (Sponaugle and Cowen 1997). Unlike most labrids, B. rufus settles directly to the reef, without burrowing in the sand. Larval duration is around 42 days (Victor 1986) and metamorphosis is gradual and occurs while these fishes remain above the substrate (Sponaugle and Cowen 1997).

Adults are mobile invertebrate feeders that predominately prey on mollusks, as well as brittle stars, crustaceans and sea urchins (Floeter et al. 2004, Bardach 2002, Randall 1967). Juveniles actively pick parasites from larger fishes and are facultative cleaners (Johnson and Ruben 1988). The fish is infrequently the prey of the Bottlenose dolphin in Florida Bay (Torres 2007).

The species is a protogynous hermaphrodite, with a dominant male guarding a permanent territory of several females (Hoffman 1983). The number of females varies throughout the distribution, ranging from 3-12 (Hoffman 1985) or up to 20 in some cases (Rocha 2000). The male will go around the territory to pair spawn with each female. Breeding cycle is acyclic, usually occurring at dusk, and mating takes place all year (Hoffman 1985). It may hybridize with spotfin hogfish, B. pulchellus.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 70 m (Ref. 9710), usually 3 - 70 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1043 specimens in 1 taxon.
Water temperature and chemistry ranges based on 731 samples.

Environmental ranges
  Depth range (m): 0.4 - 50
  Temperature range (°C): 23.704 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 37.096
  Oxygen (ml/l): 4.285 - 4.773
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.4 - 50

Temperature range (°C): 23.704 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 37.096

Oxygen (ml/l): 4.285 - 4.773

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 70m.
From 1 to 70 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits rocky or coral reefs (Ref. 9710). Feeds on brittle stars, crustaceans, mollusks, and sea urchins (Ref. 9710). Mobile invertebrate feeder (Ref. 57616). Cleaned by scarlet striped cleaner shrimp (Lysmata grabhami), goby (Gobiosoma evelynae and others), wrasse (Thalassoma trifasciatum), and hogfish (Bodianus rufus) as observed on the coral reefs in Bonaire, Netherlands Antilles (Ref. 36810). Also cleaned by Elacatinus figaro observed off the coast of São Paulo, southeastern Brazil (Ref. 40102) and by Halichoeres cyanocephalus observed off the coast of Espirito Santo, southeastern Brazil (Ref. 31373).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Forms permanent harem groups composed of a single male and several smaller females (Ref. 55398). Monandric species (Ref. 55398). Sex reversal is completed in 7-10 days (Ref. 34185, 34247). Length at sex change = 17.28 cm TL (Ref. 55398). Spawning occurs at dusk (Ref. 55398).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bodianus rufus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bodianus rufus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGTACCGCCCTAAGTTTACTAATCCGAGCAGAACTAAGCCAACCTGGCGCTCTTCTAGGAGACGACCAGATTTACAATGTTATTGTTACAGCGCACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAACTGACTTATCCCCCTAATGATCGGAGCCCCCGACATGGCTTTCCCTCGAATGAATAACATAAGCTTCTGACTTCTTCCCCCATCCTTCTTGCTTCTACTCGCTTCCTCTGGAGTAGAAGCAGGGGCCGGAACCGGTTGAACCGTTTATCCTCCACTAGCAGGCAATTTAGCCCACGCAGGAGCTTCAGTTGACCTAACGATCTTTTCTCTTCACTTAGCAGGGGTGTCGTCAATTTTGGGGGCAATTAACTTTATTACTACTATTATTAACATGAAACCTCCCGCCATCTCTCAGTATCAGACTCCACTGTTCGTGTGAGCAGTCCTAATTACGGCGGTACTTCTCCTCCTGTCCCTTCCAGTCCTTGCTGCCGGTATTACAATACTTCTAACAGATCGTAACCTTAATACCACCTTCTTTGACCCCGCAGGCGGGGGAGACCCAATCCTATATCAGCACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Xie, Y. & Russell, B.

Reviewer/s
Sadovy, Y. & Liu, M.

Contributor/s

Justification
This is a moderately large species that is not commonly marketed for food and is sometimes seen in the aquarium trade (exported from Brazil). It is widely distributed in the western Atlantic, but little is known of population and life history characterization. Given the lack of trend data, Spanish Hogfish cannot be evaluated against and described as meeting any of the threatened categories at present. No compelling evidence exists to indicate population decreases or range retractions, largely due to the absence of data. It is listed as Least Concern. However, more data is needed to determine this species population status.

Continued monitoring is required to establish population trends. Research is also needed to establish area of occupancy. It is highly recommended that density sampling performed at a large enough scale (sampling more area to obtain sound abundance-area relationships) and be conducted proportionally at all parts of the distribution.

There is a paucity of information relevant to natural population demography. The two databases that contain quantified records of the Spanish Hogfish are REEF (Reef Environment Education Foundation) and GMAD (Global Marine Aquarium Database). However, although the records are extensive both in terms of location and duration, they are either inappropriate for assessment of population trends in REEF’s case, or of highly questionable nature in GMAD’s case. The REEF data is presented as sighting frequency, and given that available information indicates patchy distribution among habitats (e.g. Gardiner and Harborne 2000, Brosnan et al 2002), unsystematic sampling may not be able to represent the spatial and temporal variability of the ecosystem. Therefore it would probably be the best to use these data, as the foundation recommends, as a detailed description of distribution range rather than for extrapolation of population trends. GMAD data regarding international trade of this species is almost certainly incomplete: while local researchers reported export of 3716 individuals during 1995-2000 in a single state of Brazil (Monteiro-Neto et al. 2003), GMAD listed only 2,251 individuals exported from the entire country in the same period, underestimating trade almost two fold.

Estimates of natural populations may be made on some very loose assumptions. Using density data from the Caribbean, estimated total coral reef area and the percentage of habitat actually utilized in the distribution (based on REEF sighting frequency data, which though cannot be used for indication of density, may instead be used as the probability of B. rufus' occurrence in a part of its distribution), an estimate of ~3,841,800 individuals is produced. The number is probably being reduced, though to what extent unknown, primarily through impacts of collection for aquarium. Exploitation pressure is unclear but probably varied throughout its distribution. Potential threats may also include habitat degradation through onshore human activities which, like overexploitation, is extensive and continuous in their habitat. Two thirds of coral reefs inB. rufus' distribution are under medium to very high threat from anthropogenic factors (Burke and Maiden 2004), but the effect on the Spanish Hogfish is indeterminable since no study has investigated as to why B. rufus' shows such strong preference for reef habitats. In general, the animal’s response to these threat factors has not been quantified and too little qualitative work exists for assumptions of generality.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No population estimates exist for Spanish Hogfishes, but an approximate estimate may be derived under very loose assumptions based on the number of individuals as the product of density, distribution area and sighting frequency (as an indication of the probability of occupancy at an area).
N= Density*Distribution area*SF%

Assumptions:
1. The average density of the animal is around 0.025/100 m2. Three estimates of density are available in the relevant literature, although of which two are from a single locality at one time (2.8 /100 m2, Pattengill-Semmens 2000, 0.5/100 m2, Brosnan et al 2002 and 0.025/100 m2, Opitz 1996). The 0.025/100 m2 density was chosen since it applies to the Caribbean locality, which constitutes the majority of the distribution. However, as the estimates clearly indicate, density distribution is extremely patchy and the average density across the entire distribution could be vastly different.

2. The fish is commonly and almost exclusively associated which coral reef habitats across its distribution (Gomon 2006). Therefore the total area of coral reef is taken as habitat range, which totals 26,960 km2 for the Caribbean and the Atlantic Brazilian coast.

3. The species occurs in low densities, and abundance is extremely patchy. Therefore sighting frequency for a particular site will be treated as probability of occurrence in a site. In this case, SF% is around 57% as average of respective SF% in different areas averaged over the known record (REEF, accessed May 4th, 2008).
Upon such assumptions, the estimated total number Spanish Hogfish is ~3,841,800 individuals. Confidence limits cannot be stated but the estimate is clearly based on very loose assumptions. In order to better grasp the overall picture of population trends, density needs to be systematically sampled for larger areas to eliminate variations between sites. More study is needed research into variability in habitat use at different sites in order to make the estimate of total population size more rigorous.

Aquarium trade export data for Brazil for 2007 are 3,177 individuals (IBAMA 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Principal threats

Studies at the Saba Reef, one of the richest fish assemblages in the Caribbean Basin, have indicated the chief threats to B. rufus and other reef fishes are overfishing and the residual impacts of the particular chemical dispersant used by the USA in the aftermath of the Deepwater Horizon oil spill; this chemical, Corexit 9500, has high persistence and toxicity to a gamut of marine fauna. Studies by Burke et al. suggest that concentrations of dispersant and other water pollutants are of particular concern in critical lagoon nurseries; these studies suggest that the toxicity of residual dispersant may be much more significant to reef fishes than the actual petroleum release of the Deepwater Horizon oil spill itself. Corexit 9500, is known to be much more toxic than the petroleum chemicals it is meant to disperse; moreover, the combined toxicity of Corexit 9500 and petroleum is more toxic to juvenile fish than either petroleum or Corexit alone.

  • Mark McGinley. 2011. Spanish hogfish. Topic ed. C.Michael Hogan. Ed.-in-chief Cutler J.Cleveland. Encyclopedia of Earth. National Council for Science and Environment. Washington DC http://www.eoearth.org/article/Spanish_hogfish?topic=49540
  • J.S.Burke, W.J.Kenworthy and L.L.Wood. 2009. Ontogenetic patterns of concentration indicate lagoon nurseries are essential to common grunts stocks in a Puerto Rican bay. Worldwide Science.org
  • Laurier Lincoln Schramm. 2000. Surfactants: fundamentals and applications in the petroleum industry. Cambridge University Press. 621 pages
  • Jeffrey T. Williams, Kent E. Carpenter, James L. Van Tassell, Paul Hoetjes, Wes Toller, Peter Etnoyer, Michael Smith. 2010. Biodiversity Assessment of the Fishes of Saba Bank Atoll, Netherlands Antilles. PloS One. 5(5): e10676.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
There are no major threats.

Exploitation and habitat degradation are probably the biggest potential threats to the Spanish Hogfish, both of which are extensive and continuing throughout its distribution. However, the lack of investigation prevents any substantial analysis of the responses to the present level of threats.

In terms of exploitation, which mainly occurs for the aquarium trade, it is estimated from GMAD data that labrids account for 6-7% of the global trade of fish (Wabnitz et al 2003). In the largest single trading country of B.rufus, Brazil (Wood 2001), the fish is under high pressure of the aquarium trade (Gasparini et al. 2004). However, databases (e.g. GMAD) as well as official figures represent underestimations of the total number of captured specimens (Gasparini et al. 2004). Furthermore, it is unknown how the pressures of exploitation are distributed in different parts of the entire distribution.

Even less clear is whether or how habitat degradation is affecting B.rufus. However, as two thirds of Caribbean reefs are under medium to high threat (Burke and Maiden 2004), the animals will be hard-pressed to find a spatial escape, should there be any detrimental impact. The degradation of reef habitats is largely anthropogenic in source, and most severe near major urban centers, where discharge of storm water and treated sewage leads to eutrophication and increased sedimentation for reefs (Burke and Maiden 2004). However, there is little information on how B.rufus utilizes the reef habitat or how sensitive it is to habitat loss of degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Management

Conservation Actions

Conservation Actions
There is little conservation action that targets the Spanish Hogfish specifically in its distribution, nor are there any limits to domestic or international trading. An exception is Florida (USA), where B.rufus is subject to a minimum and maximum size restriction of two inches and eight inches, aside from bag limits and permitting requirements. In addition, there is a limit of fifty animals per person per day, and a maximum possession limit of 100 of either at any time aboard a vessel with two or more persons licensed as required (Florida Fish and Wildlife Conservation Commission).

Continued monitoring is required to establish population trends. Research is also needed to establish areas of occupancy. It is highly recommended that density sampling performed at a large enough scale (sampling more area to obtain sound abundance-area relationships) and be conducted proportionally at all parts of the distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!