Overview

Comprehensive Description

Biology

Inhabits fringing reefs, over coral or rubble bottoms (Ref. 9710). Feeds on zooplankton in the water column (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from the Red Sea and the Gulf of Aden, including Socotra Island and Sri Lanka.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: Red Sea to Oman and South Africa; questionable records from Sri Lanka, the Philippines and Sumatra (Indonesia).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Western Indian Ocean: Gulf of Oman, Sri Lanka.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 75 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm TL (male/unsexed; (Ref. 8883))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Usually seen over bottoms of coral rubble. Feeds on zooplankton. Males maintain harems.<307>.
  • Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Cirrhilabrus rubriventralis Springer & Randall
Catalog Number: USNM 212010
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): V. Springer
Year Collected: 1971
Locality: Off Red Rock Hotel Just South of NW End G. of Aqaba, Israel, Israel, Gulf of Aqaba, Red Sea, Indian
Depth (m): 5 to 5
  • Paratype: Springer, V. G. & Randall, J. E. 1974. Israel Journal of Zoology. 23 (1): 52.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Cirrhilabrus rubriventralis Springer & Randall
Catalog Number: USNM 212009
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): V. Springer
Year Collected: 1971
Locality: Israel, Elat, Red Rock Hotel., Israel, Red Sea, Indian
  • Paratype: Springer, V. G. & Randall, J. E. 1974. Israel Journal of Zoology. 23 (1): 52.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Cirrhilabrus rubriventralis Springer & Randall
Catalog Number: USNM 212007
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): J. Randall
Year Collected: 1972
Locality: Elat, Gulf of Aqaba, Red Sea; Off Heinz Steinitz Marine Bbiology Lab, Israel, Gulf of Aqaba, Red Sea, Indian
Depth (m): 11 to 11
  • Holotype: Springer, V. G. & Randall, J. E. 1974. Israel Journal of Zoology. 23 (1): 52.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Cirrhilabrus rubriventralis Springer & Randall
Catalog Number: USNM 212008
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): J. Randall
Year Collected: 1972
Locality: Elat, Gulf of Aqaba, Red Sea; Off Heinz Steinitz Marine Biology Lab, Israel, Gulf of Aqaba, Red Sea, Indian
Depth (m): 11 to 11
  • Paratype: Springer, V. G. & Randall, J. E. 1974. Israel Journal of Zoology. 23 (1): 52.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Cirrhilabrus rubriventralis Springer & Randall
Catalog Number: USNM 212011
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): W. Smith-Vaniz
Year Collected: 1970
Locality: Gulf of Aqaba, Israel, Eilat, Behind Red Rock Hotel, Israel, Gulf of Aqaba, Red Sea, Indian
Depth (m): 3 to 3
  • Paratype: Springer, V. G. & Randall, J. E. 1974. Israel Journal of Zoology. 23 (1): 52.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits fringing reefs, over coral or rubble bottoms at depths of three to 43 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 43 m (Ref. 9710), usually 3 - 43 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 9 - 35

Graphical representation

Depth range (m): 9 - 35
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 43m.
From 3 to 43 meters.

Habitat: reef-associated. Inhabits fringing reefs, over coral or rubble bottoms (Ref. 9710). Feeds on zooplankton in the water column (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhilabrus rubriventralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTCGTATTTGGTGCTTGAGCTGGAATAGTAGGTACAGCCCTGAGCCTTCTTATTCGAGCAGAACTTAGTCAACCAGGTGCACTCCTGGGCGACGATCAAATCTATAATGTGATCGTCACTGCACACGCTTTTGTCATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGGCTTATCCCTTTAATAATTGGAGCCCCAGACATGGCATTTCCTCGAATAAATAATATGAGTTTCTGGCTTCTTCCCCCCTCCTTTCTTCTTCTTCTTGCCTCATCAGGGGTTGAAGCCGGAGCAGGAACAGGTTGGACTGTGTACCCTCCTTTAGCTGGCAATCTTGCACATGCTGGTGCCTCTGTAGATTTAACTATTTTTTCCCTTCACCTTGCAGGTATCTCCTCAATTCTAGGTGCAATCAATTTTATTACAACAATTATTAATATAAAACCTCCAGCTATTTCCCAATATCAAACACCTTTGTTTGTCTGAGCGGTGTTAATTACTGCTGTCCTGCTCCTCCTGTCACTCCCTGTCCTAGCTGCCGGAATTACAATACTTTTAACTGACCGAAATCTAAATACCACTTTCTTTGACCCAGCTGGGGGAGGGGACCCTATTCTTTACCAGCACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhilabrus rubriventralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
There is no population information available for this species. Even though C. rubriventralis is commercialized in the aquarium trade, it is not commonly traded, and it is common throughout its relatively wide range. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. It is considered common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species, although it is exploited in the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC) , IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place. This species distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cirrhilabrus rubriventralis

The social wrasse, Cirrhilabrus rubriventralis, is a species of wrasse from the western Indian Ocean from the Red Sea to South Africa, though questionable claims have been made for its occurrence out to the western Pacific. It inhabits coral reefs at depths of 3 to 43 m (9.8 to 141 ft). This species can reach a total length of 7.5 cm (3.0 in). It can be found in the aquarium trade.[2]

References[edit]

  1. ^ Rocha, L. 2010. Cirrhilabrus rubriventralis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 03 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cirrhilabrus rubriventralis" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!