Overview

Comprehensive Description

Biology

Inhabits shallow coastal waters, on sandy and muddy bottoms, and not normally found in lagoons and estuaries (Ref. 244). Feeds on small bony fishes, including sardines and anchovies, also shrimp and squid (Ref. 244). Viviparous, with 1 to 4 young in a litter; size at birth 33 to 34 cm (Ref. 244). Its flesh is highly appreciated and is marketed dried salted.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Panama to southern Brazil and Uruguay (Ref. 58839).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Information obtained from sampling off the coastal state of São Paulo, Brazil, from 1996 to 2002, such as the presence of gravid females, neonates and juveniles, indicates that R. lalandii use the area as a primary and secondary nursery ground, with subadults leaving the area as they approach maturity (Motta 2001). Among the 12,406 examined sharks in this period, 7,442 (60.01%) were R. lalandii (Motta, F.S, Gadig, O.B.F., Namora, R.C. unpubl. data). The differences in maturity sizes observed along the Brazilian coast suggest the existence of at least two different stocks of R. lalandii in the area (Motta, F.S, Gadig, O.B.F., Namora, R.C. unpubl. data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic, from Panama to southern Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

77 cm TL (female)
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 3 - 70 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Brazilian Sharpnose Shark is a tropical inshore species of the continental shelf, occurring at depths of 3 to 70 m (Compagno 1984, Gadig 1994, Cervigón and Alcalá 1999, FishBase). It is abundant from Venezuela to northern Brazil and in southern Brazil, but in northeastern Brazil, from Ceará to Bahia States, it is less common, possibly replaced by the congeneric R. porosus.

Size at maturity previously reported as 45 to 50 cm total length (TL) for males (Compagno 1984). However, size at maturity shows variation along the Brazilian coast, as follows: 52 cm TL (males) and 56 cm TL (females) on the northern coast (Lessa 1988), and 58 to 60 cm TL (males) and 63 to 65 cm TL (females) on the southeastern coast (Ferreira 1988, Motta 2001).

Placental viviparous species with litters of 1 to 5 pups (Gadig 1994, Lessa 1998, Motta 2001). Size at birth is 33 to 34 cm TL (Compagno 1984). Maximum size recorded is 78.5 cm TL (males) and 80 cm TL (females) (Namora 2003).

The diet includes mainly small teleost fishes (Sciaenidae, Clupeidae, Engraulidae), and is complemented by squid (Loliginidae) and shrimps (Penaeidae) (Compagno 1984, Silva 1997, Namora 2003). In southeastern Brazil, the diet showed sexual, seasonal and ontogenetic variation (Namora 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 22 - 29
  Temperature range (°C): 26.480 - 27.999
  Nitrate (umol/L): 0.286 - 0.926
  Salinity (PPS): 35.836 - 36.010
  Oxygen (ml/l): 4.294 - 4.430
  Phosphate (umol/l): 0.040 - 0.218
  Silicate (umol/l): 3.147 - 4.128

Graphical representation

Depth range (m): 22 - 29

Temperature range (°C): 26.480 - 27.999

Nitrate (umol/L): 0.286 - 0.926

Salinity (PPS): 35.836 - 36.010

Oxygen (ml/l): 4.294 - 4.430

Phosphate (umol/l): 0.040 - 0.218

Silicate (umol/l): 3.147 - 4.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 70m.
From 3 to 70 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits shallow coastal waters, on sandy and muddy bottoms, and not normally found in lagoons and estuaries. Feeds on small bony fishes, including sardines and anchovies, also shrimp and squid.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing with embrace (Ref. 205). Viviparous, placental (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhizoprionodon lalandii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTTCTAATTCGAGCCGAACTTGGTCAACCTGGATCTCTTTTAGGTGATGATCAGATTTACAATGTGATCGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATGGTAATACCAATTATAATTGGTGGTTTCGGAAATTGACTGGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGCTTTTGACTCCTTCCACCTTCATTCCTTCTTCTCCTAGCTTCTGCTGCAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCCCCATTAGCTAGCAATCTAGCTCACGCCGGACCATCTGTCGACCTAGCTATTTTCTCCCTTCATTTAGCCGGCGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACCATTATTAACATAAAACCACCAGCTATTTCCCAATATCAAACACCTTTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTTCTCCTTTCACTTCCAGTTCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACCACATTCTTTGATCCTGCAGGTGGGGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhizoprionodon lalandii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Rosa, R.S., Gadig, O.B.F., Santos Motta, F. & Namora, R.C.

Reviewer/s
Kyne, P.M., Cavanagh, R.D. & Fowler, S.L. (Shark Red List Authority)

Justification
A tropical inshore species widely distributed in the Western Atlantic from Panama to southern Brazil. It is common in parts of its distribution. Current population trends through much of its range are uncertain because of lack of records. It is therefore assessed as Data Deficient, although quantitative data on catches and abundance may in future demonstrate this species to be threatened in many parts of its range, where intensive coastal fisheries are occurring. Other human factors, particularly water pollution, probably impact this species and its habitat in heavily populated areas. The species is known to be decreasing through overfishing in northern Brazil. It used to be one of the most abundant elasmobranchs in coastal fisheries in Maranhão, but nowadays is rarely seen there. Increased mortality of all age classes in coastal fisheries, such as occurs off São Paulo, likely threatens heavily exploited populations of this species. The large proportion of neonates and juveniles in catches here further compromises recruitment to the adult population. The species is therefore assessed as Vulnerable in Brazil (although the acquisition of quantitative data may show it to be at a higher level of threat) due to continuing intensive coastal fishing throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Major threats include overfishing in coastal artisanal fisheries, mainly with gillnets, throughout most of its range. The species used to be one of the most abundant elasmobranch species in gillnet catches in Maranhão State, Brazil, but today it is rarely caught (Lessa 1998, R.P.T. Lessa, pers. obs.). The species is commonly taken in artisanal gillnet fisheries in São Paulo State, Brazil, corresponding to nearly 60% of the total captured shark numbers at Itanhaém Municipality (Motta 2001, Gadig et al. 2002). A large proportion of the captured individuals (nearly 70%) in this and other localities include neonates and juveniles (Motta 2001, F.S. Motta, O.B.F. Gadig and R.C. Namora, unpubl. data). In heavily populated areas, the species also suffers from effects of marine pollution. On the São Paulo coast, the species has been shown to be subject to damage from plastic debris with three specimens found with plastic collars around the head or gill region (Sazima et al. 2002).

Information is urgently required from other countries within its range.

UTILISATION
The flesh of this species is used for food, however the fins are generally not utilised due to their small size.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Protection of coastal habitats, including pollution control and establishment of marine reserves is required. Regulation and management of artisanal coastal fisheries is recommended, including delimitation of fishing areas and periods, limitation of gillnet extension and mesh sizes (minimum and maximum), and mandatory release of live neonate and juvenile specimens.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brazilian sharpnose shark

The Brazilian sharpnose shark, Rhizoprionodon lalandii, is a requiem shark of the family Carcharhinidae, found in the tropical waters of the western Atlantic Ocean between latitudes 13° N and 33° S, at depths of between 3 and 70 m. Its length is up to about 77 cm.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!