Overview

Distribution

Eastern North Pacific, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Cutthroat trout, Oncorhynchus clarkii, are widely distributed along the western coast of North America. They can be found as far north as Alaska’s Prince William Sound and as far south as California’s Eel River (Willers, 1991). Their range also extends inland where they can be found on most waterways with linkages to their western range along the Pacific coast (Trotter, 1987).

Biogeographic Regions: nearctic (Native )

  • Trotter, P. 1987. Cutthroat. Boulder Colorado: Colorado Associated University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Anadromous forms: Pacific Coast drainages from Eel River, California, north to Prince William Sound, Alaska, generally not more than 160 km inland; non-migrating fish also occur through this range. Allopatric inland forms: Rocky Mountains in Hudson Bay basin, Mississippi River basin, Great Basin (including Lahontan, Bonneville, and Alvord basins), and Pacific basin from southern Alberta south through California to the Rio Grande drainage, New Mexico, and east to Colorado and Montana (Lee et al. 1980, Page and Burr 1991). The greatest abundance of pure interior cutthroat trout occurs in Yellowstone Lake and the Yellowstone River drainage above the falls in Yellowstone National Park (Behnke 1992). Widely stocked in and out of the original range. Established in Laurentian lakes, Quebec. However, rarely has become naturalized much beyond the original distribution (Behnke 1992). Occurrence in high elevation headwater lakes is due primarily to introductions (formerly excluded by falls) (Behnke 1992). Locally common (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

There are roughly ten subspecies of cutthroat trout described by Behnke (1992). They have the same morphology, but their coloration and spotting vary. Coastal cutthroat trout, O. c. clarki, are silvery to brassy in coloration with yellowish and irregular shaped spots. West slope cutthroat trout, O. c. lewisi, are silver in coloration with a yellowish tint, but can sometimes be bright yellow, orange, or red. Their spots are similar to those of coastal cutthroat except they do not extend below the lateral line. Yellowstone cutthroat trout, O. c. bouvieri, are yellowish brown, silver, or brass in coloration with round spots evenly distributed over the body. Lahontan cutthroat trout, O. c. henshawi, are dull in coloration with large round spots evenly distributed over the entire body. Paiute cutthroat trout, O. c. seleniris, closely resemble the Lahontan cutthroat with a dull coloration, but unlike the Lahontan, Paiute cutthroat lack spots. Bonneville cutthroat trout, O. c. utah, have the same coloration and spotting as Yellowstone cutthroat with one exception, the spots are larger on Bonneville cutthroat. Colorado river cutthroat trout, O. c. pleuriticus, are strong red in coloration along the lateral line and their lower sides are colored yellow. They have spots but they vary by individual. Greenback cutthroat trout, O. c. stomias, are similar to Colorado River cutthroat in coloration, however greenback cutthroat trout have larger spots. Rio Grande cutthroat trout, O. c. virginalis, are similar to greenback cutthroat in both coloration and spotting. Rio Grande cutthroat have, in addition, close spotting on the caudal peduncle. Yellowfin cutthroat trout, O. c. macdonaldi, have the coloration of the greenback but have a silvery tint and their spots are irregular.

The subspecies all share the following characteristics: red slash marks just below their gill covers on the lower jaws (Trotter, 1987) and a scale count above the lateral line of more than 150 (Willers, 1991). Where cutthroat and rainbow trout ranges overlap, the two species can be distinguished by the presence of basibranchial teeth, or teeth on the base of the tongue (Trotter, 1987). Cutthroat trout posses them, while rainbow trout do not.

The average length for a cutthroat trout is between 20 and 40 cm while the average weight is between 2 and 4 kg. Surprisingly, the environment a cutthroat trout occupies may be the limiting factor on how big a cutthroat can get, with genetic control only being a factor in an optimal environment (Behnke, 1993).

Range mass: 19 (high) kg.

Average mass: 2-4 kg.

Range length: 99 (high) cm.

Average length: 20-40 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

  • Willers, B. 1991. Trout Biology. New York New York: Lyons & Burford.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 99 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Because O. clarkii is such a widespread species it occupies many different habitats. Cutthroat trout habitats range from coastal marine to freshwater rivers and streams with gravel substrates (Behnke, 1992). The diversity in habitat also leads to a diversity in the elevations in which the species can be found. They occur from mountainous streams in the Cascade, Rocky, and Sierra Nevada mountain ranges to the ocean.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

  • Behnke, R. 1992. Nativer Trout of Western North America. Bethesda Maryland: American Fisheries Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.385 - 2.5

Graphical representation

Depth range (m): 0.385 - 2.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Estuaries or marine waters near the coast, small rivers, gravelly streams, and isolated mountain lakes.

Spawning usually occurs in gravel stream riffles where the female digs a nest (redd) in the gravel.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In general, anadromous (sea going) and lake cutthroat trout make extensive spawning migrations; nonmigratory stream- dwelling cutthroats are often quite sedentary (Moyle 1976).

In summer and fall, radio-tagged cutthroat trout in Strawberry Reservoir in Utah had single-month home ranges that were usually about 3-4 km in maximum length (Baldwin et al. 2002).

In the Blackfoot River drainage, Montana, radio-tagged westslope cutthroat trout moved 3-72 km (mean 31 km) to access spawning tributaries (Schmetterling 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

A cutthroat trout's diet changes as they progress through the life stages. As fry they feed on small crustaceans and algae. As they progress into fingerlings they feed on small insects, and crustaceans. Juveniles and adults become opportunistic feeders, eating almost any prey item in their environment (Behnke, 1992). They are known to eat other fishes, crustaceans, and insects (Morrow, 1980).

Animal Foods: amphibians; fish; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic or marine worms

Plant Foods: algae

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods)

  • Morrow, J. 1980. The Freshwater Fishes of Alaska. Animal Resources Ecology Library: University of B.C..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic. Inland cutthroats feed primarily on insects (aquatic and terrestrial); often feeds in and especially downstream from riffle areas; some large individuals feed mostly on fishes; also eats zooplankton and crustaceans. Coastal cutthroats feed in salt water on crustaceans and fishes; in streams, they eat aquatic insects and crustaceans, also frogs, earthworms, fishes, fish eggs, salamanders, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Cutthroat trout are prey for larger fish as fry or fingerlings. As adults they become predators. When sea run cutthroat die in their natal streams, they release nutrients they acquired in the ocean as they decompose.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Young cutthroat trout are preyed on by larger fish and large, wading birds. Adult trout are preyed on by large predators, such as bears. There are several life history adaptations they posses that increases their chances of survival. Cutthroat often select spawning grounds that are isolated from spawning grounds used by other fish (Elliott, 2005). Juveniles are also sit and wait predators darting out to capture food, minimizing the time during feeding that they are susceptible to predation (Elliott, 2005). Fry and fingerling cutthroat have parmarks on their sides, which camouflage them from possible predators (Behnke, 1992).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In streams, cutthroats defend feeding territories. Population densities are regulated mostly by stream size and morphology, overwintering habitat, stream productivity, and summer cover for predator avoidance (New Mexico, Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cutthroat trout are visual predators. They depend on a keen sense of sight to locate and consume their prey. Male cutthroat trout use body signals when trying to court females for spawning (Elliott, 2005). It has been demonstrated that trout use chemical cues to re-locate natal streams for spawning.

Communication Channels: tactile

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Young cutthroat trout emerge from their eggs after two months (Elliot, 2005). Once they hatch they mature, spawn, then die. Cutthroat trout that migrate to the sea develop for up to four years in their natal stream, then migrate into the ocean only to return 2 to 3 months later to spawn (Behnke, 1992).

Development - Life Cycle: indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Cutthroat trout are not an exceptionally long lived fish. Depending on the subspecies a mature trout may live anywhere from 6-8 years (Behnke, 1992).

Typical lifespan

Status: wild:
6 to 8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Oncorhynchus clarkii are stream spawners like other fishes belonging to the Salmonidae family (Vinyard, 2004). During a spawning event a female will dig a redd, a nest in gravel (Vinyard, 2004). Males court females by nudging them with their noses and quivering (Elliott, 2005). The female lays her eggs in the redd and the male swims over and deposits his sperm.

Mating System: polygynous

Sea run cutthroat trout migrate from their marine environments to their natal streams to spawn from February to early June (Elliott, 2005). Likewise freshwater cutthroat migrate from larger rivers and lakes to smaller streams to spawn (Behnke, 1992). Females and males reach sexual maturity at around 6 years of age. Both river and sea run cutthroat can spawn several times; however, the probability of dieing during a spawning event increases with age (Behnke, 1992). A single spawning event produces 1000-2000 eggs, which, if fertilized, hatch just after 2 months of gestation (Elliott, 2005).

Breeding interval: Breeding can occur once or twice in the lifetime of a cutthroat trout.

Breeding season: Spawning occurs from spring to early summer.

Range number of offspring: 1000 to 2000.

Range time to hatching: 1 to 2 months.

Range age at sexual or reproductive maturity (female): 5 to 7 years.

Range age at sexual or reproductive maturity (male): 5 to 7 years.

Key Reproductive Features: semelparous ; iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning

Prior to fertilizationm female cutthroat trout dig a redd, a nest in gravel (Vinyard, 2004). Once eggs are deposited and become fertilized, the female covers them and may defend the redd for some time (Vinyard, 2004). After a short period of guarding, the female departs, leaving the eggs to hatch on their own. Once hatched, the parent cutthroat shows no type of parental investment.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inland populations spawn March-early July, depending on location and conditions; coastal populations usually spawn February-May (Moyle 1976, Scott and Crossman 1973). Eggs hatch in 6-8 weeks. Females are sexually mature at 3-4 years, males at 2-3 years (Sigler et al. 1983). Females spawn up to five times during their lifetime. See Stearley (1992) for a discussion of the historical ecology and life history evolution of Pacific salmons and trouts (Oncorhynchus).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus clarki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTGAGTCTACTGATTCGGGCAGAACTAAGCCAGCCGGGCGCTCTTCTAGGGGATGACCAGATCTATAACGTGATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTTATGCCAATTATGATCGGAGGCTTTGGAAACTGATTAATTCCCTTAATAATCGGGGCCCCTGATATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCTCCATCCTTTCTCCTCCTCCTATCTTCATCTGGAGTTGAAGCCGGCGCTGGTACTGGATGAACAGTTTACCCCCCTCTGGCCGGTAACCTCGCCCATGCAGGAGCCTCTGTTGATTTAACTATCTTCTCCCTCCATTTAGCTGGAATCTCCTCAATTTTGGGAGCCATTAATTTTATTACGACCATTATTAACATAAAACCTCCGGCTATCTCTCAATACCAAACCCCCCTTTTTGTTTGAGCTGTGCTAGTCACTGCTGTCCTTCTATTACTTTCCCTTCCCGTCCTGGCAGCAGGCATTACTATGTTACTTACAGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGAGACCCAATTCTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus clarki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Oncorhynchus clarkii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTCTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTGAGTCTACTGATTCGGGCAGAACTAAGCCAGCCGGGCGCTCTTCTAGGGGAT---GACCAGATCTATAACGTAATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTTATGCCAATTATGATCGGGGGCTTTGGAAACTGATTAATTCCCTTAATAATCGGGGCCCCTGATATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCTCCATCCTTTCTCCTCCTCCTATCTTCATCTGGAGTTGAAGCCGGCGCCGGTACTGGATGAACAGTTTACCCCCCTCTGGCCGGTAACCTCGCCCATGCAGGAGCCTCTGTTGATTTAACTATCTTCTCCCTTCATTTAGCTGGAATCTCCTCAATTTTGGGAGCCATTAATTTTATTACGACCATTATTAACATAAAACCTCCGGCTATCTCTCAATACCAAACCCCCCTTTTTGTTTGAGCTGTGCTAGTCACTGCTGTCCTTCTATTACTTTCCCTTCCCGTCCTGGCAGCAGGCATTACTATGTTACTTACAGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGAGACCCAATTCTATACCAACACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATTCTCATCCTCCCAGGCTTTGGTATGATTTCACATATCGTTGCATACTACTCCGGCAAAAAAGAACCCTTCGGATATATAGGAATAGTCTGAGCTATAATAGCCATCGGATTATTAGGATTTATCGTTTGAGCCCACCACATGTTTACTGTCGGGATAGACGTGGACACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus clarkii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 61
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Currently, cutthroat trout are not on the IUCN red list. There are some factors that may put these fish on the list soon. Through stocking streams, rivers, and ponds with rainbow trout throughout the west we may be putting native cutthroat trout in harms way. Cutthroat trout and rainbow trout readily mate, creating hybrids that are themselves able to mate (Behnke, 1992). Cutthroat trout are also poor competitors, out-competed by all other trout species (Trotter, 1987). If we continue to introduce non-native trout to cutthroat streams and rivers, cutthroat trout may be eliminated. Another factor affecting cutthroat trout is habitat loss. Logging and excessive agriculture cause sedimentation in trout streams, making them inhabitable and unsuitable for reproduction (Behnke, 1992). Three subspecies of Oncorhynchus clarkii are threatened throughout the western states.

US Federal List: threatened

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Declines have occurred primarily because of habitat degradation/destruction and the effects of introduced trout species. The greatest threat is introgressive hybridization among subspecies and with rainbow trout/steelhead (Allendorf and Leary 1988). This is a major concern in inland populations, but hybridization may also occur in coastal populations (Baker et al. 2002).

Subspecies macdonaldi (yellowfin cutthroat), formerly in Twin Lakes, Lake County, Colorado, is extinct apparently due to introgressive hybridization with rainbow trout and competition from deep-water lake trout (Miller et al. 1989).

An unnamed subspecies from Alvord Basin, southeastern Oregon (Trout Creek) and northwestern Nevada (Virgin Creek), is extinct as a pure form, apparently due to hybridization and introgression with introduced rainbow trout; no genetically pure populations are known (Miller et al. 1989).

Behnke (1992) described instances in which cutthroat trout were quickly replaced by brook trout, both with and without associated habitat disturbance.

Sea-run cutthroat underwent a major decline in the 1970s and 1980s, evidently due to habitat damage and overfishing; for populations above Bonneville Dam, dam passage takes a toll; in many areas, native stocks have been eroded by introductions of hatchery stock (Nehlsen et al. 1991).

See also records for the various subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Where non-native trout pose a threat to native cutthroat trout populations and restoration, isolated headwater reaches managed for cutthroat trout should be as large and diverse as possible, and improvements may be needed to ensure that habitat requirements are met (Novinger and Rahel 2003).

Management Requirements: Though most high-elevation populations have been exposed to hybridization and are not pure native trout, Behnke (1992) noted that they do maintain the appearance of native trout and recommended that they be recognized and managed as such.

See Nehlsen et al. (1991) for general protection and management recommendations for anadromous salmonids.

Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

See also files for subspecies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative impacts of cutthroat trout on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Cutthroat trout are an important sport fish throughout northwestern North America (Trotter, 1987; Coad, 1995). They are also indicative of healthy ecosystems.

Positive Impacts: food

  • Coad, B. 1995. Encyclopedia of Canadian fishes. Singapore: Canadian Museum of Nature and Canadian Sportfishing Productions Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cutthroat trout

The cutthroat trout (Oncorhynchus clarkii) is a species of freshwater fish in the salmon family of order Salmoniformes.[2] It is one of the many fish species colloquially known as trout. All subspecies of cutthroat trout are sought after gamefish, especially among anglers who enjoy fly fishing.

Several native subspecies of cutthroat are currently listed as threatened, generally due to loss of habitat and introduction of non-native species.

Contents

Range and habitat[edit]

Cutthroat trout are native to western North America. The cutthroat species has evolved through geographic isolation into many subspecies, each native to a different major drainage basin. Native cutthroat species are found along the Pacific Northwest coast, in the Cascade Range, the Great Basin, and throughout the Rocky Mountains. Some coastal populations are anadromous, living primarily in the Pacific Ocean as adults and returning to fresh water from fall through early spring to feed on insects and spawn. Most populations, however, stay in freshwater throughout their lives and are known as non-migratory, stream-resident or riverine populations. Anadromous fish may reach weights of 20 pounds (9 kg), but those fish which remain permanently in freshwater may only reach a weight of 2 pounds (1 kg). At least three subspecies are confined to isolated basins in the Great Basin and can tolerate saline or alkaline water.

Description[edit]

Throughout their native and introduced range, cutthroat trout vary widely in size, coloration, and habitat selection. Though their coloration can range from golden to gray to green on the back, and depending on subspecies strain and habitat, they usually feature distinctive red, pink, or orange linear marks along the underside of the mandible in the lower folds of the gill plates; the easiest diagnostic of the species for the casual observer. These markings are responsible for the formation of the typical name "cutthroat". At maturity, different populations and subspecies of cutthroat can range from 6–40 inches (15–100 cm) in length, depending on habitat and food availability, making size an ineffective indicator as to species identity. Cutthroat are typically prized as a sportfish, particularly by fly anglers, as their propensity to inhabit remote waters and diminutive streams appeals to the sense of adventure present in many outdoor enthusiasts. In addition, their tendency to exhibit significant activity and resistance to anglers in conjunction with this species' affinity for terrestrial or mature insects serves to increase popularity of the cutthroat as an angler's quarry. Finally, the cutthroat participates in a unique predator-prey relationship with the bull trout that is key to ecosystem integrity across much of its natural range.

Cutthroat will readily interbreed with the closely related rainbow trout, producing fertile hybrids commonly called "cutbow". As this species generally bears similar coloration and overall appearance to the cutthroat, retaining the characteristic orange-red slash, these hybrids often pose a taxonomical difficulty. In addition, cutthroat will also hybridize with the O. gilae subspecies, the Gila trout and Apache trout in regions where their ranges overlap.

Subspecies[edit]

There are many subspecies of cutthroat, each native to a separate geographic area. The cutthroat trout is thought by scientists to have evolved over the past two million years from other Oncorhynchus species which migrated up the Columbia and Snake river basins. There are at least 10, and perhaps more than 14 subspecies,[2][3] including:

Pacific Coast[edit]

Great Basin[edit]

Likely O. c. utah, northern Utah

Northern Rockies[edit]

Southern Rockies[edit]

Symbol[edit]

The cutthroat trout is the state fish of Idaho and Wyoming, while particular subspecies of cutthroat are the state fish of Colorado, Montana, Nevada, New Mexico, and Utah.

Origin of the name[edit]

The common name "cutthroat" refers to the distinctive red coloration on the underside of the lower jaw.

Cutthoat trout were given the species name clarki in honor of William Clark, who co-led the Lewis and Clark Expedition of 1804–1806.[1] One of Lewis and Clark’s missions was to describe the flora and fauna encountered during the expedition. The type specimen of O. clarki was described by naturalist John Richardson from a tributary of the lower Columbia River, identified as the "Katpootl",[1] which was perhaps the Lewis River as there was a Multnomah village of similar name at the confluence. This type specimen was most likely the coastal cutthroat subspecies.

References[edit]

  1. ^ a b c Richardson, John; William Swainson, William Kirby (1836), Fauna boreali-americana, or, The zoology of the northern parts of British America: containing descriptions of the objects of natural history collected on the late northern land expedition, under command of Captain Sir John Franklin, R.N., London: J. Murray, pp. 225–226 
  2. ^ a b "Oncorhynchus clarkii". Integrated Taxonomic Information System. Retrieved 23 April 2009. 
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2005). "Oncorhynchus clarki" in FishBase. 10 2005 version.
  4. ^ a b c Behnke, Robert J. Native Trout of Western North America. American Fisheries Society, 1992 p. 65.
  5. ^ Species Profile: Lahontan cutthroat trout, U.S. Fish & Wildlife Service
  6. ^ Species Fact Sheet: Lahontan cutthroat trout, U.S. Fish & Wildlife Service
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Salmo (Smith and Stearley 1989).

Coastal interior forms were once recognized as separate species.

Behnke (1992) regarded O. clarki as comprising four major subspecies and 10 minor subspecies (some extinct or undescribed). He stated that some of the subspecies, such as stomias (greenback) and pleuriticus (Colorado River), might logically be combined, but he preferred to keep them separate because of their historical value and their use in management and restoration programs.

Hybridizes with rainbow and golden trouts. Morphometric criteria may be insensitive in identifying populations introgressed with rainbow trout (Leary et al. 1984). Allele frequencies can be used to identify genetically pure populations (Leary et al. 1987).

According to Allendorf and Leary (1988), coastal, Lahontan, and westslope subspecies of O. clarki are electrophoretically divergent from other subspecies, closer to rainbow trout. However, mtDNA comparisons agree with other systematic and zoogeographical evidence that all subspecies of cutthroat trout are more closely related to each other than any of them is to rainbow trout (Gyllensten and Wilson 1987). Much of the genetic variation within west slope cutthroat (subspecies lewisi) results from alleles found in only one or two local populations (Allendorf and Leary 1988).

Forbes and Allendorf (1991) found that mitochondrial genotypes had no detectable effects on meristic traits in interbreeding trouts of the subspecies lewisi (westslope) and bouveri (Yellowstone), which exhibit substantial genetic divergence.

Cutthroat trout from the Alvord and Whitehorse basins, Oregon and Nevada, have been listed by some authors as comprising two undescribed subspecies; allozyme data indicate that the Virgin Creek population is the product of introgressive hybridization between rainbow and cutthroat trout, whereas the Whitehorse Basin populations probably represent indigenous cutthroat trout of the area (Bartley and Gall 1991). Bartley and Gall (1991) recommended that subspecific names not be used for cutthroat trout from Virgin Creek in the Alvord Basin, Nevada. However, Behnke (2002) published Carl Hubbs's previously unpublished description of Oncorhynchus clarki alvordensis, thus making that name available.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!