Overview

Comprehensive Description

Biology

A common (Ref. 9710) territorial species that inhabits coral reefs, juveniles usually encountered among branches of yellow stinging coral, Millepora. Adults are found in very shallow waters of coral reefs, usually near top of outer edge where there are caves, holes, and abundant fire coral (Ref. 26938). Feed primarily on algae but also on polyps of fire coral (Ref. 3139) and other invertebrate animal material (Ref. 13442). Juveniles occasionally pick parasites from other species of fish (Ref. 3139). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Occasionally marketed fresh (Ref. 3139). Have been reared in captivity (Ref. 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: southern Florida (USA) and Bermuda through the Caribbean Sea to Brazil (Ref. 40101).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 14 - 15; Analspines: 2; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 210 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

21.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Tail bright yellow. Juveniles dark blue with transparent tail and electric blue spots on side (Ref. 26938). Adults dark yellowish brown, the edges of the scales darker (Ref 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Microspathodon chrysurus
Catalog Number: USNM 37455
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Poey
Locality: Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Type: Poey, F. 1876. Anales de la Sociedad Espanola de Historia Natural Madrid. 5: 144.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 120 m (Ref. 10797), usually 0 - 10 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2775 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1862 samples.

Environmental ranges
  Depth range (m): 0.4 - 32.8
  Temperature range (°C): 24.448 - 28.067
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 4.285 - 4.773
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.4 - 32.8

Temperature range (°C): 24.448 - 28.067

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 4.285 - 4.773

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 120m.
Recorded at 120 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A common (Ref. 9710) territorial species that inhabits coral reefs, juveniles usually encountered among branches of yellow stinging coral, Millepora. Found in very shallow waters of coral reefs, usually near top of outer edge where there are caves, holes, and abundant fire coral (Ref. 26938). Feeds primarily on algae but also on polyps of fire coral (Ref. 3139) and other invertebrate animal material (Ref. 13442). Territorial herbivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Microspathodon chrysurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGGACAGCCCTAAGCCTTCTCATTCGGGCGGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTTATTGTTACCGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTCATCCCCCTTATGATTGGAGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTTTGACTCCTTCCCCCTTCATTCCTCCTTCTACTTGCCTCCTCCGGTGTCGAAGCAGGTGCGGGGACAGGATGAACCGTCTATCCTCCACTATCCGGTAACCTGGCCCACGCAGGAGCCTCTGTAGACCTAACCATCTTTTCTCTCCACCTAGCAGGTATCTCCTCTATCCTGGGAGCAATTAATTTTATTACCACAATTATTAACATGAAACCACCTGCCATCTCTCAATACCAAACCCCTCTCTTCGTATGGGCCGTACTTATTACTGCCGTCCTACTACTTTTATCTCTCCCTGTACTAGCTGCAGGAATTACCATGCTCCTGACCGATCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGTGACCCTATTCTATACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Microspathodon chrysurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Microspathodon chrysurus


Microspathodon chrysurus is a Damselfish from the Western Atlantic. It occasionally makes its way into the aquarium trade, where it is known as the Marine Jewelfish (not to be confused with the freshwater Cichlid, known as the Jewelfish) . It grows to a size of 21cm in length. When juvenile it has brilliant (metallic) blue spots on a dark blue back ground. It is probably the most aggressive of all Damselfish, and should be kept with fish substantially larger and more robust than itself.

Gallery

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!