Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Comprehensive Description

Biology

Adults are found more commonly from 80 to 200 m, over rock, sand, gravel or shells, usually at temperatures between 4° and 10°C. Feed mainly on small bottom-living organisms including crustaceans, mollusks, echinoderms, worms and fishes (sand lance, capelin, silver hake, American eels, herring and argentines) (Ref. 5951). A batch spawner (Ref. 51846). Undertakes extensive migrations in the Barents Sea and Iceland. Sold fresh, chilled as fillets, frozen, smoked and canned. Also utilized for fish meal and animal feeds. Can be steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The common haddock Melanogrammus aeglefinus is a member of the cod-like fish family. Members have an elongate, tapering body and usually long dorsal and anal fins. Haddock have three dorsal fins and two anal fins. They are easily recognised by the first dorsal fin which is considerably higher than the others, more triangular in outline and has a slightly concave trailing margin. The lateral line is dark in colouration. The haddock has a short and rounded nose, big eyes and a small mouth. It is grey in colouration with dusky brown blotches.Melanogrammus aeglefinus is a valuable species that is exploited commercially in mixed trawl and seine fisheries, along with cod (Gadus morhua) and whiting (Merlangius merlangus), and is a bycatch in Norway lobster (Nephrops norvegicus) fisheries (Hedger et al., 2004). Spawning takes place from March to May, at depths of 100-150 m (Alekseeva & Tormosova, 1979). The easiest ways to tell a haddock from a cod (Gadus morhua) are by the dark colouring of the lateral line and the presence of a dusky blotch just below either of the first dorsal fins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, North West Atlantic, Oosterschelde, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Atlantic: Bay of Biscay to Spitzbergen; in the Barents Sea to Novaya Zemlya; around Iceland; rare at the southern Greenland. Northwest Atlantic: Cape May, New Jersey to the Strait of Belle Isle.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Strait of Belle Isle to New Jersey
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic (including western Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Both sides of the North Atlantic. Western Atlantic: Most abundant from the southern part of the Grand Bank and from the more easterly of the Nova Scotian Banks to Cape Cod.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

112 cm TL (male/unsexed; (Ref. 5951)); max. published weight: 16.8 kg (Ref. 9988); max. reported age: 20 years (Ref. 4645)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 100.0 cm TL (male/unsexed); max. weight: 17 kg.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Mouth relatively small; lower jaw shorter than the upper jaw; chin barbel rather small. Lateral line dark, uninterrupted to about the end of the body. Lateral-line pores present on head. Scales overlapping. A large dark blotch is above the pectoral fin just below the lateral line.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 10 - 450 m, usually 10 - 200 m (Ref. 35388)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found inshore to the edge of the continental shelf, to depths of 200 m, over rock, sand or gravel bottoms.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 422497 specimens in 1 taxon.
Water temperature and chemistry ranges based on 343500 samples.

Environmental ranges
  Depth range (m): -9 - 516
  Temperature range (°C): -1.960 - 15.532
  Nitrate (umol/L): 1.139 - 25.613
  Salinity (PPS): 6.521 - 35.584
  Oxygen (ml/l): 2.495 - 8.280
  Phosphate (umol/l): 0.249 - 1.829
  Silicate (umol/l): 0.987 - 42.456

Graphical representation

Depth range (m): -9 - 516

Temperature range (°C): -1.960 - 15.532

Nitrate (umol/L): 1.139 - 25.613

Salinity (PPS): 6.521 - 35.584

Oxygen (ml/l): 2.495 - 8.280

Phosphate (umol/l): 0.249 - 1.829

Silicate (umol/l): 0.987 - 42.456
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The common haddock is a demersal species and shoals in colder waters at depths of 40-300 m. It can be found over rock, sand, gravel or shells.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 450m.
From 10 to 450 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; marine; depth range 10 - 450 m. Commonly at depths 80 - 200 m, over rock, sand, gravel or shells, and at temperatures 4° - 10°C.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds mainly on benthic organisms (Ref. 26807). Preyed upon by cod, pollock, white hake, harbor and grey seals. Parasites of the species include Lepidapedon rachion, Myxidium bergense, a coccidian parasite Eimeria gadi, 4 protozoans, 2 myxosporidians, 2 trematodes, 2 cestodes, 6 nematodes, 2 acanthocephalans and 4 copepods (Ref. 5951). See also Ref. 8999.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Small bottom-living organisms including crustaceans, molluscs, echinoderms, worms and fishes.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / pathogen
Icthyophonus hoferi infects muscle of Melanogrammus aeglefinus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Melanogrammus aeglefinus (Haddock) is prey of:
Melanogrammus aeglefinus
Hemitripterus americanus
Leucoraja erinacea
Leucoraja ocellata
Amblyraja radiata
Squalus acanthias
Lophius americanus
Cynoscion
Pomatomus saltatrix

Phocidae
Chondrichthyes
Homo sapiens

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning occurs in typically marine waters between 50 and 150 m depth.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning occurs in typically marine waters between 50 and 150 m depth.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanogrammus aeglefinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCTTAAGCCTGCTCATTCGAGCAGAGCTAAGTCAACCTGGTGCACTTCTAGGTGAT---GATCAAATTTATAATGTGATTGTCACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTCGGAAACTGACTCATTCCTCTAATGATTGGTGCCCCAGATATGGCTTTCCCTCGAATAAACAACATAAGTTTCTGACTTCTTCCTCCATCTTTTCTGCTTCTTTTAGCATCCTCTGGAGTAGAAGCTGGAGCTGGTACAGGTTGAACTGTTTATCCCCCTTTAGCTGGAAACCTCGCTCATGCTGGGGCATCTGTTGACCTCACTATTTTTTCTCTTCATCTAGCCGGAATTTCATCAATTCTTGGAGCAATTAATTTTATTACCACAATTATTAATATAAAACCTCCTGCAATTTCACAATATCAAACACCCCTTTTTGTTTGAGCAGTCCTAATTACAGCTGTGCTTCTGCTATTATCTCTTCCCGTCTTAGCCGCCGGTATCACAATACTTTTAACTGATCGTAACCTCAATACTTCTTTCTTTGATCCTGCTGGAGGAGGGGACCCCATTTTATATCAGCATTTATTCTGATTCTTCGGTCATCCCGAAGTATACATTCTAATTTTACCTGGATTCGGAATAATTTCTCACATCGTAGCGTACTATTCAGGTAAAAAAGAACCTTTCGGATATATAGGAATAGTTTGAGCTATGATGGCCATTGGCCTTCTTGGCTTTATTGTATGAGCCCACCACATATTTACAGTCGGGATAGACGTAGATACACGTGCCTACTTTACATCTGCAACCATAATTATTGCCATTCCAACAGGTGTAAAAGTTTTTAGCTGATTAGCAACCCTGCATGGAGGC---TCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Melanogrammus aeglefinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 90
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1d+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sobel, J.

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A1d+2d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: experimental; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Haddock

The haddock (Melanogrammus aeglefinus) is a marine fish distributed on both sides of the North Atlantic. Haddock is a popular food fish and is widely fished commercially.

The haddock is easily recognized by a black lateral line running along its white side (not to be confused with pollock which has the reverse, i.e. white line on black side) and a distinctive dark blotch above the pectoral fin, often described as a "thumbprint" or even the "Devil's thumbprint" or "St. Peter's mark".[1]

Haddock is most commonly found at depths of 40 to 133 m (130 to 436 ft), but has a range as deep as 300 m (980 ft). It thrives in temperatures of 2 to 10°C (36 to 50°F). Juveniles prefer shallower waters and larger adults deeper water. Generally, adult haddock do not engage in long migratory behaviour as do the younger fish, but seasonal movements have been known to occur across all ages. Haddock feed primarily on small invertebrates, although larger members of the species may occasionally consume fish.

Growth rates of haddock have changed significantly over the past 30 to 40 years. Presently, growth is more rapid, with haddock reaching their adult size much earlier than previously noted. However, the degree to which these younger fish contribute to reproductive success of the population is unknown. Growth rates of haddock, however, had slowed in recent years. Some evidence indicates it may be the result of an exceptionally large year class in 2003.[2] Spawning occurs between January and June, peaking during late March and early April. The most important spawning grounds are in the waters off middle Norway, near southwest Iceland, and Georges Bank. An average-sized female produces approximately 850,000 eggs, and larger females are capable of producing up to 3 million eggs each year.

Contents

Parasites

Cod and related species are plagued by parasites. For example the cod worm, Lernaeocera branchialis, starts life as a copepod, a small, free-swimming crustacean larva. The first host used by cod worm is a flatfish or lumpsucker, which they capture with grasping hooks at the front of their bodies. They penetrate the lumpsucker with a thin filament which they use to suck its blood. The nourished cod worms then mate on the lumpsucker.[3][4]

The female worm, with her now fertilized eggs, then finds a cod, or a cod-like fish such as a haddock or whiting. There, the worm clings to the gills while it metamorphoses into a plump, sinusoidal, wormlike body, with a coiled mass of egg strings at the rear. The front part of the worm's body penetrates the body of the cod until it enters the rear bulb of the host's heart. There, firmly rooted in the cod's circulatory system, the front part of the parasite develops like the branches of a tree, reaching into the main artery. In this way, the worm extracts nutrients from the cod's blood, remaining safely tucked beneath the cod's gill cover until it releases a new generation of offspring into the water.[3][4]

Fisheries

Fins, barbel and lateral line on a haddock. Haddocks, like all cod, have three dorsal fins and two anal fins.

Reaching sizes up to 1.1 m (3 ft 7 in), haddock is fished for year-round. Some of the methods used are Danish seine nets, trawlers, long lines and fishing nets. The commercial catch of haddock in North America had declined sharply in recent years, but is now recovering, with recruitment rates running around where they historically were from the 1930s to 1960s.[5]

In 2010, Greenpeace International has added the haddock to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[6]

Haddock populations on the offshore grounds of Georges Bank off New England and Nova Scotia have made a remarkable comeback with the adoption of catch shares management program, and are currently harvested at only a fraction of sustainable yields.

As food

Smoked Haddock served with onions and red peppers
Haddock, roast
Nutritional value per 100 g (3.5 oz)
Energy469 kJ (112 kcal)
Carbohydrates0.0 g
- Dietary fiber0.0 g
Fat0.93 g
Protein24.24 g
Thiamine (vit. B1)0.040 mg (3%)
Riboflavin (vit. B2)0.045 mg (4%)
Niacin (vit. B3)4.632 mg (31%)
Pantothenic acid (B5)0.150 mg (3%)
Vitamin B60.346 mg (27%)
Folate (vit. B9)13 μg (3%)
Vitamin C0.00 mg (0%)
Calcium42 mg (4%)
Iron1.35 mg (10%)
Magnesium50 mg (14%)
Phosphorus241 mg (34%)
Potassium399 mg (8%)
Zinc0.48 mg (5%)
Percentages are relative to
US recommendations for adults.
Source: USDA Nutrient Database

Haddock is a very popular food fish, sold fresh, smoked, frozen, dried, or to a small extent canned. Haddock, along with cod and plaice, is one of the most popular fish used in British fish and chips.

Fresh haddock has a clean, white flesh and can be cooked in the same ways as cod. Freshness of a haddock fillet can be determined by how well it holds together, as a fresh one will be firm; also, fillets should be translucent, while older fillets turn chalky (nearly opaque). Young, fresh haddock and cod fillets are often sold as scrod in Boston, Massachusetts; this refers to the size of the fish which have a variety of sizes, i.e. scrod, markets, and cows. Haddock is the predominant fish of choice in Scotland in a fish supper. It is also the main ingredient of Norwegian fishballs (fiskeboller).

Unlike the related cod, haddock does not salt well and is often preserved by drying and smoking.

The smoking of haddock was highly refined in Grimsby. Traditional Grimsby smoked fish (mainly haddock, but sometimes cod) is produced in the traditional smokehouses in Grimsby, which are mostly family-run businesses that have developed their skills over many generations.[7] Grimsby fish market sources its haddock from the North East Atlantic, principally Iceland, Norway and the Faroe Islands. These fishing grounds are sustainably managed[8] and have not seen the large scale depreciation in fish stocks seen in EU waters.[9]

One popular form of haddock is Finnan haddie which takes its name from the fishing village of Finnan or Findon in Scotland, where it was originally cold-smoked over peat. Finnan haddie is often served poached in milk for breakfast.[10]

The town of Arbroath on the east coast of Scotland produces the Arbroath smokie. This is a hot-smoked haddock which requires no further cooking before eating.

Smoked haddock naturally has an off-white colour; it is very often dyed yellow, as are other smoked fish. Smoked haddock is the essential ingredient in the Anglo-Indian dish kedgeree.

Notes

Other references

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!