Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occur in rocky and coral reef areas (Ref. 9710), where they are found in pairs and small groups (Ref. 48636). Feed on algae (Ref. 9710). Oviparous (Ref. 205), monogamous (Ref. 52884). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs from the southwest tip of south Korea and southern Japan and the Ryukyu Islands, south to northern Java along the upper continental shelf including the Gulf of Thailand (Allen 1980, Pyle 2001, G.R. Allen pers. comm. 2006). It has been recorded from four to at least 25 m in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Japan to Thailand; including the Ryukyu Islands, Taiwan, the South China Sea, and the Gulf of Thailand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 22 - 25; Analspines: 3; Analsoft rays: 18 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 190 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

19.0 cm TL (male/unsexed; (Ref. 2272))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Body golden yellow, diagonal stripes reddish, snout black, eye bar black, forehead bar white immediately behind eye bar. Snout length 2.9-3.4 in HL. Body depth 1.3-1.5 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is associated with rocky reefs and coral areas. It is usually solitary, but pairs can be observed. Animals graze on algal-covered rocks, presumably supplementing this diet with other food items such as benthic invertebrates and coral polyps (Allen 1980, G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 2 - 6.7
  Temperature range (°C): 23.822 - 24.198
  Nitrate (umol/L): 0.343 - 0.430
  Salinity (PPS): 32.183 - 32.495
  Oxygen (ml/l): 4.847 - 4.847
  Phosphate (umol/l): 0.246 - 0.441
  Silicate (umol/l): 14.847 - 15.721

Graphical representation

Depth range (m): 2 - 6.7

Temperature range (°C): 23.822 - 24.198

Nitrate (umol/L): 0.343 - 0.430

Salinity (PPS): 32.183 - 32.495

Phosphate (umol/l): 0.246 - 0.441

Silicate (umol/l): 14.847 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 4 - 25m.
From 4 to 25 meters.

Habitat: reef-associated. Occurs in rocky and coral reef areas (Ref. 9710). Feeds on algae (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 4 - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 2 - 6.7
  Temperature range (°C): 23.822 - 24.198
  Nitrate (umol/L): 0.343 - 0.430
  Salinity (PPS): 32.183 - 32.495
  Oxygen (ml/l): 4.847 - 4.847
  Phosphate (umol/l): 0.246 - 0.441
  Silicate (umol/l): 14.847 - 15.721

Graphical representation

Depth range (m): 2 - 6.7

Temperature range (°C): 23.822 - 24.198

Nitrate (umol/L): 0.343 - 0.430

Salinity (PPS): 32.183 - 32.495

Phosphate (umol/l): 0.246 - 0.441

Silicate (umol/l): 14.847 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in rocky and coral reef areas.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon wiebeli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCTGGGATAGTGGGCACTGCCCTAAGTCTGCTCATCCGAGCAGAGCTCAGCCAACCAGGCTCCCTCCTGGGCGACGATCAGATCTATAACGTAATTGTTACGGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGAAACTGACTGATCCCTCTAATGATTGGGGCCCCAGACATAGCCTTTCCTCGGATGAATAATATGAGCTTTTGGCTTCTGCCCCCCTCCTTCTTCCTACTCCTTGCCTCTTCTGGCGTAGAGTCCGGGGCTGGTACCGGATGAACGGTTTATCCCCCACTAGCTGGCAACCTGGCACACGCCGGGGCATCCGTTGATCTAACCATCTTCTCCCTCCACCTCGCAGGAGTTTCCTCCATCCTCGGGGCAATTAATTTCATCACAACAATTCTCAACATGAAGCCCCCTGCCATGTCTCAGTACCAAACCCCTCTTTTCGTGTGATCTGTTTTAATTACAGCCGTCCTGCTTCTCCTGTCCCTCCCCGTCCTTGCAGCCGGGATTACAATACTCCTTACAGATCGAAACCTAAATACGACCTTTTTCGATCCCGCAGGGGGAGGTGATCCTATTCTGTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon wiebeli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This species is generally common, and it occurs on both rocky and coral reefs. There appear to be no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations (G.R. Allen pers. comm. 2006). It is most common off the coast of China (G.R. Allen pers. comm. 2006).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is likely to be present within marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!