Overview

Brief Summary

WhyReef - Lifestyle

Neon damselfish spend their days feeding within their school, and darting in and out of coral. When they’re young, they stay around fire coral for protection. As they get older, their schools grow in size and they explore parts of the reef.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit lagoon and seaward reefs, close to the bottom among rubble beds. Feed on zooplankton and to a lesser extent on benthic algae. Juveniles often school among soft corals. Adults in small groups or congregate in large numbers over favorable sections of reef (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The neon damselfish is one of the most common fish on the reef. It is a small fish that swims in large groups, or schools, because it is less likely to be eaten in a big group than alone.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Sri Lanka to the Line and Tuamoto islands, north to southern Japan, south to Rowley Shoals and Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 2; Analsoft rays: 14 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 90 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This brilliant blue damsel has more yellow ventrally than P. pavo (Ref. 1602). Yellow-orange tail and posterior parts of dorsal and anal fins (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 106 specimens in 1 taxon.
Water temperature and chemistry ranges based on 68 samples.

Environmental ranges
  Depth range (m): 0.2 - 62.7
  Temperature range (°C): 25.245 - 29.266
  Nitrate (umol/L): 0.016 - 2.714
  Salinity (PPS): 33.821 - 35.383
  Oxygen (ml/l): 4.338 - 4.802
  Phosphate (umol/l): 0.108 - 0.507
  Silicate (umol/l): 0.803 - 4.989

Graphical representation

Depth range (m): 0.2 - 62.7

Temperature range (°C): 25.245 - 29.266

Nitrate (umol/L): 0.016 - 2.714

Salinity (PPS): 33.821 - 35.383

Oxygen (ml/l): 4.338 - 4.802

Phosphate (umol/l): 0.108 - 0.507

Silicate (umol/l): 0.803 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 20m.
From 1 to 20 meters.

Habitat: reef-associated. Inhabits lagoon and seaward reefs, close to the bottom among rubble beds. Feeds on zooplankton and to a lesser extent on benthic algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit lagoon and seaward reefs, close to the bottom among rubble beds. The favoured habitat consists of outer reefs in clear water, frequently among coral rubble in areas exposed to slight wave action or strong currents (Ref. 54301). Adults in small groups or congregate in large numbers over favorable sections of reef (Ref. 48636). Feed on zooplankton and plants (Ref. 26990).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

Neon damselfish eat zooplankton—microscopic animals that live in the sea. They also snack on turf algae from time to time. Since they eat both animals and plants, they are omnivores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacentrus coelestis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTCGGTGCCTGAGCTGGAATAGTAGGCACAGCCTTAAGCCTTCTTATTCGGGCAGAACTAAGCCAACCCGGCGCACTCCTAGGAGACGACCAAATTTATAACGTCATTGTTACCGCACATGCCTTTGTTATGATTTTCTTTATAGTAATGCCAATTCTAATTGGAGGGTTTGGGAACTGATTAGTCCCCCTTATGCTCGGCGCCCCCGATATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTACTTGCTTCTTCTGGAGTTGAGGCAGGAGCCGGGACAGGTTGAACTGTATACCCCCCACTGTCTGGAAATTTAGCCCACGCGGGGGCATCAGTAGACCTAACCATCTTTTCTCTCCACCTAGCAGGTGTGTCATCAATTTTAGGGGCAATTAACTTCATTACCACCATTATTAACATGAAACCACCCGCCATCTCACAATACCAAACTCCTTTATTTGTGTGAGCCGTCCTAATTACTGCTGTGCTCCTTCTTCTTTCCCTTCCAGTCTTAGCTGCTGGTATCACCATGCTATTAACTGACCGAAATCTCAACACCACGTTCTTCGACCCTGCAGGAGGAGGAGATCCAATTCTGTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomacentrus coelestis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 66
Specimens with Barcodes: 76
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Reefs are in danger, and that means so is the home of the neon damselfish!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pomacentrus coelestis

The neon damselfish, pomacentrus coelestis is a Damselfish from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 9cm in length.Their natural colors include neon blue,green,and yellowish-orange.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!