Overview
Brief Summary
WhyReef - Lifestyle
Neon damselfish spend their days feeding within their school, and darting in and out of coral. When they’re young, they stay around fire coral for protection. As they get older, their schools grow in size and they explore parts of the reef.
-
Encyclopedia of Life. World Wide Web electronic publication. www.eol.org, version (08/2009).
http://www.eol.org
-
Froese, R. and D. Pauly. Editors. 2009.FishBase. World Wide Web electronic publication. www.fishbase.org, version (07/2009).
http://www.fishbase.de/Summary/speciesSummary.php?ID=7229&genusname=Amblyeleotris&speciesname=fasciata
-
Zipcode Zoo. World Wide Web electronic publication. www.zipcodezoo.com, version (08/2009).
http://zipcodezoo.com/Animals/A/Amblyeleotris_fasciata/
Trusted
Comprehensive Description
Biology
Adults inhabit lagoon and seaward reefs, close to the bottom among rubble beds. Feed on zooplankton and to a lesser extent on benthic algae. Juveniles often school among soft corals. Adults in small groups or congregate in large numbers over favorable sections of reef (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
-
Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793
Trusted
WhyReef - Fun Facts
The neon damselfish is one of the most common fish on the reef. It is a small fish that swims in large groups, or schools, because it is less likely to be eaten in a big group than alone.
-
Encyclopedia of Life. World Wide Web electronic publication. www.eol.org, version (08/2009).
http://www.eol.org
-
Froese, R. and D. Pauly. Editors. 2009.FishBase. World Wide Web electronic publication. www.fishbase.org, version (07/2009).
http://www.fishbase.de/Summary/speciesSummary.php?ID=7229&genusname=Amblyeleotris&speciesname=fasciata
-
Zipcode Zoo. World Wide Web electronic publication. www.zipcodezoo.com, version (08/2009).
http://zipcodezoo.com/Animals/A/Amblyeleotris_fasciata/
Trusted
Distribution
Indo-Pacific: Sri Lanka to the Line and Tuamoto islands, north to southern Japan, south to Rowley Shoals and Lord Howe Island.
-
Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793
Trusted
Physical Description
Morphology
Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 2; Analsoft rays: 14 - 15
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
9.0 cm TL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Diagnostic Description
This brilliant blue damsel has more yellow ventrally than P. pavo (Ref. 1602). Yellow-orange tail and posterior parts of dorsal and anal fins (Ref. 48636).
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Ecology
Habitat
Environment
reef-associated; non-migratory; marine; depth range 1 - 20 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Depth range based on 106 specimens in 1 taxon.
Water temperature and chemistry ranges based on 68 samples.
Environmental ranges
Depth range (m): 0.2 - 62.7
Temperature range (°C): 25.245 - 29.266
Nitrate (umol/L): 0.016 - 2.714
Salinity (PPS): 33.821 - 35.383
Oxygen (ml/l): 4.338 - 4.802
Phosphate (umol/l): 0.108 - 0.507
Silicate (umol/l): 0.803 - 4.989
Graphical representation
Depth range (m): 0.2 - 62.7
Temperature range (°C): 25.245 - 29.266
Nitrate (umol/L): 0.016 - 2.714
Salinity (PPS): 33.821 - 35.383
Oxygen (ml/l): 4.338 - 4.802
Phosphate (umol/l): 0.108 - 0.507
Silicate (umol/l): 0.803 - 4.989
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 68 samples.
Environmental ranges
Depth range (m): 0.2 - 62.7
Temperature range (°C): 25.245 - 29.266
Nitrate (umol/L): 0.016 - 2.714
Salinity (PPS): 33.821 - 35.383
Oxygen (ml/l): 4.338 - 4.802
Phosphate (umol/l): 0.108 - 0.507
Silicate (umol/l): 0.803 - 4.989
Graphical representation
Depth range (m): 0.2 - 62.7
Temperature range (°C): 25.245 - 29.266
Nitrate (umol/L): 0.016 - 2.714
Salinity (PPS): 33.821 - 35.383
Oxygen (ml/l): 4.338 - 4.802
Phosphate (umol/l): 0.108 - 0.507
Silicate (umol/l): 0.803 - 4.989
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 1 - 20m.
From 1 to 20 meters.
Habitat: reef-associated. Inhabits lagoon and seaward reefs, close to the bottom among rubble beds. Feeds on zooplankton and to a lesser extent on benthic algae.
From 1 to 20 meters.
Habitat: reef-associated. Inhabits lagoon and seaward reefs, close to the bottom among rubble beds. Feeds on zooplankton and to a lesser extent on benthic algae.
Trusted
Trophic Strategy
Inhabit lagoon and seaward reefs, close to the bottom among rubble beds. The favoured habitat consists of outer reefs in clear water, frequently among coral rubble in areas exposed to slight wave action or strong currents (Ref. 54301). Adults in small groups or congregate in large numbers over favorable sections of reef (Ref. 48636). Feed on zooplankton and plants (Ref. 26990).
-
Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793
Trusted
Associations
WhyReef - Menu
Neon damselfish eat zooplankton—microscopic animals that live in the sea. They also snack on turf algae from time to time. Since they eat both animals and plants, they are omnivores.
-
Encyclopedia of Life. World Wide Web electronic publication. www.eol.org, version (08/2009).
http://www.eol.org
-
Froese, R. and D. Pauly. Editors. 2009.FishBase. World Wide Web electronic publication. www.fishbase.org, version (07/2009).
http://www.fishbase.de/Summary/speciesSummary.php?ID=7229&genusname=Amblyeleotris&speciesname=fasciata
-
Zipcode Zoo. World Wide Web electronic publication. www.zipcodezoo.com, version (08/2009).
http://zipcodezoo.com/Animals/A/Amblyeleotris_fasciata/
Trusted
Life History and Behavior
Life Cycle
Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
-
Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pomacentrus coelestis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTAGTATTCGGTGCCTGAGCTGGAATAGTAGGCACAGCCTTAAGCCTTCTTATTCGGGCAGAACTAAGCCAACCCGGCGCACTCCTAGGAGACGACCAAATTTATAACGTCATTGTTACCGCACATGCCTTTGTTATGATTTTCTTTATAGTAATGCCAATTCTAATTGGAGGGTTTGGGAACTGATTAGTCCCCCTTATGCTCGGCGCCCCCGATATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTACTCCCCCCATCCTTCCTTCTCCTACTTGCTTCTTCTGGAGTTGAGGCAGGAGCCGGGACAGGTTGAACTGTATACCCCCCACTGTCTGGAAATTTAGCCCACGCGGGGGCATCAGTAGACCTAACCATCTTTTCTCTCCACCTAGCAGGTGTGTCATCAATTTTAGGGGCAATTAACTTCATTACCACCATTATTAACATGAAACCACCCGCCATCTCACAATACCAAACTCCTTTATTTGTGTGAGCCGTCCTAATTACTGCTGTGCTCCTTCTTCTTTCCCTTCCAGTCTTAGCTGCTGGTATCACCATGCTATTAACTGACCGAAATCTCAACACCACGTTCTTCGACCCTGCAGGAGGAGGAGATCCAATTCTGTACCAACACCTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pomacentrus coelestis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 66
Specimens with Barcodes: 76
Species With Barcodes: 1
Public Records: 66
Specimens with Barcodes: 76
Species With Barcodes: 1
Trusted
Genomic DNA is available from 5 specimens with morphological vouchers housed at British Antarctic Survey
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
WhyReef - Threats
Reefs are in danger, and that means so is the home of the neon damselfish!
-
Encyclopedia of Life. World Wide Web electronic publication. www.eol.org, version (08/2009).
http://www.eol.org
-
Froese, R. and D. Pauly. Editors. 2009.FishBase. World Wide Web electronic publication. www.fishbase.org, version (07/2009).
http://www.fishbase.de/Summary/speciesSummary.php?ID=7229&genusname=Amblyeleotris&speciesname=fasciata
-
Zipcode Zoo. World Wide Web electronic publication. www.zipcodezoo.com, version (08/2009).
http://zipcodezoo.com/Animals/A/Amblyeleotris_fasciata/
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
http://www.fishbase.org/references/FBRefSummary.php?id=4537&speccode=1255
Trusted
Wikipedia
Pomacentrus coelestis
| Wikimedia Commons has media related to: Pomacentrus coelestis |
The neon damselfish, pomacentrus coelestis is a Damselfish from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 9cm in length.Their natural colors include neon blue,green,and yellowish-orange.
References
- Froese, Rainer, and Daniel Pauly, eds. (2008). "Pomacentrus coelestis" in FishBase. December 2008 version.
| This Pomacentridae article is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



