Overview

Comprehensive Description

Biology

Adults inhabit coral reefs (Ref. 9710). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Males may be brooding at 5.0-5.5 cm SL (Ref. 5316). Also found in lagoons and seaward reefs (Ref 90102).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Corythoichthys amplexus is distributed from the Gulf of Oman and Seychelles, eastwards to the Somoa Islands. This species is distributed in the western Pacific from the Ryukyu Islands to the Great Barrier Reef. C. amplexus is also known from Fiji (type locality).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa to Samoa, north to Ryukyu Islands, south to the Great Barrier Reef. Record from the Mascarenes (Ref. 9408) is apparently erroneous (Ref. 33390).
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 22 - 30; Analsoft rays: 4
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm SL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by broad reddish-brown bands interspread with narrower pale bands; 10 caudal rays; rings 14 - 16 + 35 - 39; discontinuous superior trunk and tail ridges; straight lateral trunk ridge, ends near anal ring; continuous inferior trunk and tail ridges; length of snout 2.1-2.8 in head length; depth of snout 3.7-5.4 in snout length; head length 8.4-12.0 in SL (Ref 90102).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Corythoichthys amplexus Dawson & Randall
Catalog Number: USNM 213511
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Collette
Year Collected: 1970
Locality: New Guinea**Madang Harbour, Inside S.Tip Paeowai Island. Pile Of branching coral About 12 Ft. Across depth: 30-35 Ft.Gear: Rotenone, Papua New Guinea, Pacific
Depth (m): 9 to 11
  • Paratype: Dawson, C. E. & Randall, J. E. 1975. Proceedings of the Biological Society of Washington. 88 (25): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Corythoichthys amplexus Dawson & Randall
Catalog Number: USNM 213510
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer, M. Gomon & Indonesians
Year Collected: 1974
Locality: Tallabassi Bay, Just Off N.E. Tip of Big Damalawa Islet, Kabaena Island, Celebes (= Sulawesi), Big Damalawa Islet, Kabaena Island, Indonesia, Suluwesi Islands, Tallabassi Bay, Pacific
Depth (m): 2 to 15
  • Paratype: Dawson, C. E. & Randall, J. E. 1975. Proceedings of the Biological Society of Washington. 88 (25): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Corythoichthys amplexus Dawson & Randall
Catalog Number: USNM 213480
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Carlson & B. Goldman
Year Collected: 1974
Locality: Fiji Island, Beqa Lagoon, Patch Reef Between Stuart and Yanuca Islands, Fiji, Fiji Islands, Pacific
  • Paratype: Dawson, C. E. & Randall, J. E. 1975. Proceedings of the Biological Society of Washington. 88 (25): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Corythoichthys amplexus Dawson & Randall
Catalog Number: USNM 213479
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): B. Carlson & B. Goldman
Year Collected: 1974
Locality: Fiji Islands, Beqa Lagoon, Patch Reef Between Stuart and Yanuca Islands, Fiji, Fiji Islands, Pacific
Depth (m): 6 to 6
  • Holotype: Dawson, C. E. & Randall, J. E. 1975. Proceedings of the Biological Society of Washington. 88 (25): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Corythoichthys amplexus is a demersal species typically found in the tropics and subtropics to a maximum depth of 31 m. It is known from coral reefs, lagoons, harbours, and open sandy-flats. Also reported on rubble along edges of reefs (Kuiter 2000) and in patch reefs surrounded by sandy flats (Nanami and Nishihira 2002). Males carry the eggs in a brood pouch which is found under the tail.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 31 m (Ref. 37816)
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 3 - 18
  Temperature range (°C): 25.689 - 28.575
  Nitrate (umol/L): 0.066 - 0.355
  Salinity (PPS): 32.464 - 35.312
  Oxygen (ml/l): 4.427 - 4.812
  Phosphate (umol/l): 0.131 - 0.350
  Silicate (umol/l): 0.819 - 4.403

Graphical representation

Depth range (m): 3 - 18

Temperature range (°C): 25.689 - 28.575

Nitrate (umol/L): 0.066 - 0.355

Salinity (PPS): 32.464 - 35.312

Oxygen (ml/l): 4.427 - 4.812

Phosphate (umol/l): 0.131 - 0.350

Silicate (umol/l): 0.819 - 4.403
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corythoichthys amplexus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CACTCTTTACCTGATCTTTGGTGCCTGAGCCGGAATAGTTGGCACTGCCCTCAGTCTGCTGATCCGATCTGAACTCAACCAACCCGGGGCATTACTAGGCGATGACCAGATTTATAATGTAATCGTCACTGCCCATGCATTTGTGATAATCTTTTTTATAGTAATACCTATCATAATTGGAGGCTTCGGCAACTGGCTTGTGCCTTTAATAATCGGGGCCCCAGACATAGCATTCCCTCGGATAAACAACATGAGCTTCTGATTGCTCCCACCATCTTTTCTCCTTCTATTGGCCTCCTCAGGTATCGAAGCAGGGGCCGGAACAGGTTGAACACTGTACCCTCCCCTTGCCGGAAACCTGGCGCACGCTGGACCCTCTGTAGACCTTACTATCTTCTCCCTTCATTTAGCAGGGGTATCCTCAATTCTAGGGGCTGTCAACTTTATCACCACCATCCTCAACATAAAACCACCTTCTATTTCCCAATTCCAGACGCCCTTGTTCGTATGGGCTGTCCTTATTACCGCAGTACTGCTTCTTCTTTCTCTTCCGGTTCTGGCAGCTGGAATCACAATGCTATTAACCGACCGTAATCTTAACACTACTTTTTTTGACCCGGCTGGGGGCGGTGATCCTATTTTATACCAGCACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corythoichthys amplexus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Fritzsche, R., Matsuura, K., Allen, G., Collette, B., Nelson, J., Dooley, J., Carpenter, K., Bartnik, S., Robinson, E. & Morgan, S.K.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Corythoichthys amplexus has been assessed as Least Concern. This wide-ranging species is not known to be significantly impacted by any major threats although maybe undergoing localised declines due to coral reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for Corythoichthys amplexus.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Corythoichthys amplexus has no known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures in place for Corythoichthys amplexus, however its distribution may coincide with a number of marine protected areas including the Great Barrier Reef Marine Park.

All sygnathids are subject to export controls of the Coomonwealth Wildlife Protection (Regulation of Exports and Imports) Act 1982 since 1998.

All syngnathids and solenostomids are listed as marine species under s248 of the EPBC Act 1999.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Corythoichthys amplexus

Corythoichthys amplexus, known commonly as the Brown-banded Pipefish, is a species of marine fish in the family Syngnathidae. [2]

The Brown-banded Pipefish is widespread throughout the tropical waters of the Indo-West Pacific region, from the eastern coast of Africa to the Samoa Islands. [3]

The Brown-banded Pipefish is a small size fish and can reach a maximum size of 10 cm length. [4]

References[edit]

  1. ^ Fritzsche, R., Matsuura, K., Allen, G., Collette, B., Nelson, J., Dooley, J., Carpenter, K., Bartnik, S., Robinson, E. & Morgan, S.K. 2010. Corythoichthys amplexus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 15 October 2013.
  2. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  3. ^ http://www.iucnredlist.org/details/155165/0
  4. ^ http://www.fishbase.org/summary/6659
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!