Overview

Comprehensive Description

Biology

Predominantly neritic species avoiding very turbid waters and areas with reduced salinity such as estuaries. May form schools of varying size. Feeds on a variety of fishes, cephalopods, and crustaceans, particularly stomatopod larvae and prawns (Ref. 9684). Marketed mainly fresh and dried salted (Ref. 9684), but also smoked, canned and frozen (Ref. 9987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa east to New Guinea, north to southern Japan, south to northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Red Sea and East Africa to New Guinea, north to Japan, south to Australia. Reported in New Zealand (Ref. 89192).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This Indo-West Pacific species is found from the Red Sea and East Africa to Papua New Guinea, north to Japan, and south to Australia. The population does not appear to be continuous.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Djibouti, Eritrea, Mozambique, Red Sea, Somalia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1360 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

145 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 35.9 kg (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A small species, deepest near the middle of the first dorsal fin base. The second dorsal fin is higher than the first dorsal fin; the pectoral fins are short to moderately long; swim bladder is absent or rudimentary. Lower sides and belly silvery white with colorless elongate oval spots arranged in horizontally oriented rows. The dorsal, pectoral and pelvic fins are blackish; the tip of the second dorsal and anal fins are washed with yellow; the anal fin is silvery; the dorsal and anal finlets are yellow with grayish margins; the caudal fin is blackish, with streaks of yellow green.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Predominantly neritic species avoiding very turbid waters and areas with reduced salinity such as estuaries. May form schools of varying size. Feeds on a variety of fishes, cephalopods, and crustaceans, particularly stomatopod larvae and prawns (Ref. 9684). Marketed mainly fresh and dried salted (Ref. 9684), but also smoked, canned and frozen (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 10 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is pelagic and oceanodromous. It is a predominantly neritic species avoiding very turbid waters and areas with reduced salinity such as estuaries. It may form schools of varying size. It feeds on a variety of fishes, cephalopods, and crustaceans, particularly stomatopod larvae and prawns.

Maximum size is about 130 cm fork length (FL), and longevity at least five years. The smallest mature female in Thailand was 43 cm (FL), although fifty percent of females in the Gulf of Thailand were mature at 39.6 cm (FL). Fecundity of fish ranging in size from 43.8–49.1 cm varies from 1.2–1.9 million eggs (Collette and Nauen 1983, Yesaki 1994, Collette 2010). In Australia, longevity is estimated to be about 10 years (Wilson 1981), and age at first maturity in Thailand is estimated to be two years (Boonragsa 1987). This species may live as long as 18 years in the central Indo-Pacific (Grifiths et al. 2009).

This species probably spawns more than once a year, perhaps in two spawning seasons in the Gulf of Thailand. Spawning of this species is reported to be confined to coastal waters, based on the occurrence of their larvae which were collected at surface water temperatures of 28°C (Nishikawa and Ueyanagi 1991). It appears there are two distinct spawning seasons for this species off the west coast of Thailand: a major spawning period during the northeast monsoon from January to April and a minor spawning period during the southwest monsoon in August-September. Spawning is also apparently seasonal for this species off Papua New Guinea and off New South Wales, occurring during the austral summer (Yesaki 1994).

Maximum size is 130 cm FL. The all-tackle game fish record is of a 35.9 kg fish caught off Montague Island, New South Wales, Australia in 1982 (IGFA 2011).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Terranova Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Scolex Infestation (Scolex pleuronectis). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocycnus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metapseudaxine Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 21. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 19. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thunnus tonggol

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTTTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTTCTTCCCCCCTCTTTCCTTCTGCTCCTAGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTGGCCCACGCAGGGGCATCAGTTGACCTAACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGAGCTGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCTGGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCCGGATTCGGAATAATCTCCCACATTGTTGCCTACTACTCAGGTAAAAAAGAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATCGTATGAGCCCACCACATGTTCACAGTAGGAATGGACGTAGACACACGGGCATACTTTACATCCGCAACTATGATTATCGCAATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCAACCCTTCACGGGGGAGCTGTTAAGTGAGAAACCCCTCTGCTATGAGCCATTGGCTTTATTTTCCTCTTTACAGTTGGAGGACTAACAGGTATTGTCCTAGCCAATTCATCTTTAGACATCGTTCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTACTATCTATGGGAGCTGTATTCGCCATTGTTGCCGCCTTCGTACACTGATTCCCACTATTCACAGGGTACACCCTTCACAGCACATGAACTAAAATCCACTTCGGAGTAATGTTCGTAGGTGTCAATCTTACATTCTTCCCACAGCACTTCCTAGGACTAGCAGGAATGCCTCGACGGTATTCAGACTACCCAGATGCCTACACCCTTTGAAACACAATTTCCTCTATTGGATCCCTTATCTCCCTAGTAGCAGTAATTATGTTCCTATTTATTATTTGAGAAGCTTTCGCTGCCAAACGTGAAGTAATGTCAGTAGAACTAACTTCAACTAACGTTGAATGACTACACGGCTGCCCTCCGCCATACCACACATTCGAAGAGCCTGCATTCGTTCTAGTCCAATCAGACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus tonggol

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Di Natale, A., Fox, W., Juan Jorda, M., Miyabe, N., Nelson, R., Sun, C. & Uozumi, Y.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species grows more slowly and lives longer than other tuna species of similar size. Coupled with their restricted neritic distribution, Longtail Tuna may be vulnerable to overexploitation by fisheries. Worldwide landings have been rapidly increasing, but there is no effort information or stock assessments. It is listed as Data Deficient. More information is needed on the status of this species population, including better catch data and effort information. Management of this species also needs to be included under a fisheries management organization.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no known stock assessments for this species. FAO reported worldwide landings show a gradual increase from 600 tonnes in 1950 to 250,030 tonnes in 2006 (FAO 2009). There is no effort information for this species. In recent years, the countries attributed with the highest catches of longtail tuna are Indonesia, Iran, Oman, Yemen and Pakistan (IOTC 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are two major fishing grounds for Longtail Tuna, one off the South China Sea coast of Thailand and Malaysia and the other off countries bordering the North Arabian Sea. Longtail tuna is caught mainly by gillnet and in a lesser extent by artisanal purse seiners.This species is caught in the recreational fishery in Australia, and is caught as bycatch in trawling. Most of the global catch is taken in the western Indian Ocean. Catch of this species is increasing in many areas but landings are frequently confused with Yellowfin Tuna in some regions.

This species grows more slowly and live longer than other tuna species of similar size. Coupled with their restricted neritic distribution, longtail tuna may be vulnerable to overexploitation by fisheries, and caution needs to be exercised in managing the species until more reliable biological and catch data are collected to assess the status of the population (Griffiths et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. More research is needed to determine the impact of fisheries on this species population, including better catch and effort information, and more comprehensive stock assessments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thunnus tonggol

Thunnus tonggol is a species of tuna of tropical Indo-West Pacific waters. It is commonly known as the longtail tuna[1] or northern bluefin tuna.[3][4] The usage of the latter name, mainly in Australia to distinguish it from the southern bluefin tuna, leads to easy confusion with Thunnus thynnus of the Atlantic and Thunnus orientalis of the North Pacific. Compared to these "true" bluefins, Thunnus tonggol is more slender and has shorter pectoral fins.[3][4]

Thunnus tonggol reaches 145 centimetres (57 in) in length and 35.9 kilograms (79 lb) in weight.[5] Compared to similar-sized tunas, its growth is slower and it lives longer, which may make it vulnerable to overfishing.[1]

See also

References

  1. ^ a b c Collette, B., Di Natale, A., Fox, W., Juan Jorda, M., Miyabe, N., Nelson, R., Sun, C. & Uozumi, Y. (2011). "Thunnus tonggol". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/170351. Retrieved 6 December 2011.
  2. ^ "Thunnus tonggol". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=172430.
  3. ^ a b Hutchins, B. & Swainston, R. (1986). Sea Fishes of Southern Australia. pp. 104 & 141. ISBN 1-86252-661-3
  4. ^ a b Allen, G. (1999). Marine Fishes of Tropical Australia and South-East Asia. p. 230. ISBN 0-7309-8363-3
  5. ^ Froese, Rainer, and Daniel Pauly, eds. (2011). "Thunnus tonggol" in FishBase. December 2011 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!