Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Description

This large, fast-swimming tuna is an important target for numerous commercial fisheries around the world. The streamlined body of the bigeye tuna is dark metallic blue on the back, white on the undersides, and bears moderately long pectoral fins, used for balancing and breaking. The first dorsal fin is deep yellow, while the second dorsal fin and anal fin are pale yellow, and small fins just behind the dorsal and anal fins, called finlets, are bright yellow edged with black (2) (3). The length of the anal fin and the larger eyes of the bigeye tuna, after which it is named, distinguish this species from the similar yellowfin tuna (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Bigeye tunas are excellent swimmers, with a number of remarkable adaptations which make them efficient predators of the ocean. Unlike many other fish, they cannot pump water over their gills, but instead, swim with their mouth open which forces water over their gills. While this is an efficient way of getting water over their gills, it means that if they stop swimming, they will suffocate. The gills of tuna cover a surface area up to 30 times larger than other fish, giving a large surface over which water can flow, enabling about half the oxygen present in the water to be absorbed. The hearts of tuna are also much larger than those of other fish; about ten times as large, relative to the size of the body. This, along with a high blood pressure, creates perfect conditions to rapidly transfer oxygen from the gills to other tissues (6). As well as adaptations to enhance the amount of oxygen reaching the muscles, a unique system to regulate their body temperature enables tuna to maintain their body temperature above that of the ocean. This system is called the rete mirabile; a counter-current heat exchange system which prevents heat from being lost to the surroundings. This maximises the efficiency of the muscles and maintains good brain and eye function, allowing the bigeye tuna to forage in cold water (6). Juvenile and small adult bigeye tunas school at the ocean's surface, sometimes together with yellowfin or skipjack tuna, and often associated with floating objects (2), while adult bigeye tunas are found in deeper water (5). The bigeye tunas migrate between feeding grounds in temperate waters and their spawning grounds in tropical waters; however, they are on the move almost all the time as they search for areas of plentiful food (6). Bigeye tunas feed on a variety of fish, cephalopods and crustaceans; which it searches for in the daytime and nighttime. Bigeye tunas become prey themselves for larger billfish and toothed whales (2). Mature bigeye tuna spawn at least twice a year; releasing between an incredible 2.9 million and 6.3 million eggs each time. In the eastern Pacific, spawning has been recorded between 10°N and l0° S throughout the year, peaking between April and September in the northern hemisphere and between January and March in the southern hemisphere (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Occur in areas where water temperatures range from 13°-29°C, but the optimum is between 17° and 22°C. Variation in occurrence is closely related to seasonal and climatic changes in surface temperature and thermocline. Juveniles and small adults school at the surface in mono-species groups or mixed with other tunas, may be associated with floating objects. Adults stay in deeper waters (Ref. 5377). Eggs and larvae are pelagic (Ref. 6390). Feed on a wide variety of fishes, cephalopods and crustaceans during the day and at night (Ref. 9340). Meat is highly prized and processed into sashimi in Japan. Marketed mainly canned or frozen (Ref. 9684), but also sold fresh (Ref. 9340).
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: tuna (English), atún (Espanol)
 
Thunnus obesus (Lowe, 1839)


Bigeye tuna


Body elongate, fusiform, deep, deepest under center of first dorsal base, moderately compressed; eye large; no fatty eyelid; teeth slender, conical; top of tongue with 2 cartilaginous ridges; 23-31 gill rakers; 2 dorsal fins barely separated; 1st  dorsal XIII-XV; 8-9 finlets after dorsal and anal fins; pectoral fins moderately long, in fish ~ 110 cm tip is pointed down and fin reaches past 2nd  dorsal; short, forked bony process between pelvic fins; two small keels separated by large keel on tail base; well developed scaly corselet on front of body; small scales cover body behind corselet.

Back metallic dark blue, lower sides and belly whitish; a lateral iridescent blue band running along sides of live fish; fish to 110 cm with wide, continuous white bars on rear half of body, larger fish without bars; first dorsal fin yellow; second dorsal and anal fins pale yellow; finlets bright yellow, edged with black; tail dark grey, no white rear border.


Maximum size, 250 cm; all-tackle world record 197.2 Kg.

Habitat: oceanic pelagic.

Depth: 0-1500 m.

Circumglobal in tropical and temperate seas; southern California to the mouth of the Gulf of California to Chile and the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Azores, Azores Exclusive Economic Zone, Chagos, Comores, Djibouti, East Indian Ocean, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mozambique, Mtwapa, New Zealand Exclusive Economic Zone, North Pacific, North West Atlantic, Portuguese Exclusive Economic Zone, Reunion, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania, Ungama Bay, United Kingdom Exclusive Economic Zone, Western Indian Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Indian and Pacific: in tropical and subtropical waters. Absent in the Mediterranean. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Indian and Pacific: in tropical and subtropical waters. Absent in the Mediterranean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and temperate seas, including Mascarenes, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 1500 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in the Atlantic, Pacific and Indian Oceans, but does not occur in the Mediterranean (2). Bigeye tunas are most commonly found in tropical and subtropical waters, but its distribution does extend into temperate waters. There are considered to be separate stocks in the Eastern Pacific, Western Pacific, Atlantic and Indian Oceans (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 14 - 15; Analspines: 0; Analsoft rays: 14; Vertebrae: 39
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 250.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2500 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 27000)); max. published weight: 210.0 kg (Ref. 9987); max. reported age: 11 years (Ref. 30326)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A large species, deepest near the middle of the first dorsal fin base. Lower sides and belly whitish; a lateral iridescent blue band runs along the sides in live specimens. The first dorsal fin is deep yellow, the second dorsal and anal fins are light yellow, the finlets are bright yellow edged with black.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in areas where water temperatures range from 13°-29°C, but the optimum is between 17° and 22°C. Variation in occurrence is closely related to seasonal and climatic changes in surface temperature and thermocline. Juveniles and small adults school at the surface in mono-species groups or mixed with other tunas, may be associated with floating objects. Feeds on a wide variety of fishes, cephalopods and crustaceans during the day and at night (Ref. 9340). Spawning occurs in waters between 10°N and 10°S throughout the year but occurs most often from April up to the end of September (Ref. 9340). Meat is highly prized and processed into sashimi in Japan. Marketed mainly canned or frozen (Ref. 9684), but also sold fresh (Ref. 9340).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 250 m (Ref. 168), usually 0 - 50 m (Ref. 89423)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This pelagic and oceanodromous species occurs in waters with temperatures ranging from 13–29°C, but the optimum is between 17°C and 22°C. Variation in occurrence is closely related to seasonal and climatic changes in surface temperature and thermocline. Juveniles and small adults school at the surface in monospecific groups or mixed with other tunas, and may be associated with floating objects. Adults stay in deeper waters (Maigret and Ly 1986). This species is mostly found above 500 m, but can dive deeper. This species feeds on a wide variety of fishes, cephalopods and crustaceans during the day and at night (Collette 1995).

Eggs and larvae are pelagic (Kailola et al. 1993). This species is a multiple spawner that may spawn every one or two days over several months (Nikaido et al. 1992). They spawn over periods of the full moon, and spawn throughout the year in tropical waters (Kailola et al. 1993). Although spawning apparently occurs widely across the equatorial Pacific Ocean, the greatest reproductive potential appears to be in the eastern Pacific, based on apparent maturation, size frequencies, and catch per unit of effort (Kikawa 1966). In the eastern and central Pacific, spawning has been recorded between 15°N and 15°S and between 105–175°W during most months when sea surface temperatures exceeded 24°C with a peak from April through September in the northern hemisphere and between January and March in the southern hemisphere. Spawning is primarily at night between 1900 and 0400 hr. The average mature female spawned every 2.6 days. The estimated mean relative fecundity is 24 oocytes/g body weight. The number of eggs per spawning has been estimated at 2.9–6.3 million (Collette 2010).

Longevity for this species may vary by region. Estimated maximum age for this species in the Western Pacific is 16 years (Farley et al. 2006), in the Indian Ocean is eight years (Tankevich 1982), in the Atlantic Ocean is nine years (Hallier et al. 2005), and in the Eastern Pacific is five years (Schaefer and Fuller 2006).

Age at first maturity is estimated to be about two years (Nootmorn 2004, Farley et al. 2006). However, Calkins (1980) reports a sexual maturity for this species at 100–130 cm at an age of about three years old. Minimum length at sexual maturity for females can be 80–102 cm, and predicted length at 50% maturity of 102–135 cm (approximately 3.5 years of age) has also been reported in different areas. Males tend to dominate the catches over the entire size range (Collette 2010).

The generation length for this species is between 4.4 and five years based on age structure data across different stocks (Collette et al. 2011).

The all-tackle game fish record is of a 197.31 kg fish caught off Cabo Blanco, Peru in 1957 (IGFA 2011) .

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occur in areas where water temperatures range from 13°-29°C, but the optimum is between 17° and 22°C. Variation in occurrence is closely related to seasonal and climatic changes in surface temperature and thermocline.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 53849 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51764 samples.

Environmental ranges
  Depth range (m): 0 - 4905
  Temperature range (°C): 0.964 - 27.910
  Nitrate (umol/L): 0.057 - 32.875
  Salinity (PPS): 31.060 - 37.257
  Oxygen (ml/l): 2.538 - 7.433
  Phosphate (umol/l): 0.022 - 2.318
  Silicate (umol/l): 0.492 - 129.091

Graphical representation

Depth range (m): 0 - 4905

Temperature range (°C): 0.964 - 27.910

Nitrate (umol/L): 0.057 - 32.875

Salinity (PPS): 31.060 - 37.257

Oxygen (ml/l): 2.538 - 7.433

Phosphate (umol/l): 0.022 - 2.318

Silicate (umol/l): 0.492 - 129.091
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column, Flotsam

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The bigeye tuna inhabits oceanic waters from the surface down to a depth of 250 metres, in temperatures from 13° to 29° C (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Temperature and thermocline depth seem to be the main environmental factors governing the vertical and horizontal distribution of this species (Ref. 168). Bigeye tuna are more tolerant of lower temperatures and lower dissolved oxygen concentration than are other tunas and tend to occupy deeper waters (Ref. 30326). For example, during the day, adult bigeye tuna inhabit the thermocline zone at about 150-250 m in tropical waters where temperatures descend to almost 10°C, provided dissolved oxygen concentration is more than 1 mg per l (Ref. 28952, 30327). The tuna make occassional short ascents to 100 m or shallower (Ref. 6390).Young bigeye tuna have not been reported outside tropical waters (Ref. 30326). In Australia, bigeye tuna smaller than 20 kg may form surface-dwelling schools of similar sized fish with other species such as yellowfin tuna and skipjack tuna (Katsuwonus pelamis). Schools of only bigeye tuna are less common (Ref. 30328). In tropical waters, young bigeye tuna are often caught 50-100 m below floating objects such as logs and fish aggregating devices (Ref. 30326). Adults tend to be solitary (Ref. 6390). Behavioural studies in Hawaiian waters using ultrasonic tags (Ref. 30329) found that the distribution of adult bigeye tuna was closely correlated with the 15°C isotherm during the day (Ref. 6390). Like yellowfin tuna, bigeye tuna move into the warmer surface waters (within 50 m of the surface) at night. Feed during the day and at night. In Hawaii, more abundant in late fall through late spring.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Univietellodidymocytis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Univietellodidymocytis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sphyriocephalus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sphyriocephalus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sibitrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocycnus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Orbitonematobothrium Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Opisthorchinematobothrium Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neonematobothrioideis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neohexostoma Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nematobothrium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nasicola Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metazoan Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kudoa Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma thynni Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma sibi Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma grossum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma acutum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dinurus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymosulcus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation18. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 9. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 23. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 20. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dermatodidymocystis vivipira Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dermatodidymocystis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dermatodidymocystis indicus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dasyrhynchus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cardicola Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Capsala Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 18. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 17. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 9. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brachiella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Botulus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Areotestis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Are multiple spawners that may spawn every 1 or 2 days over several months (Ref. 30330). They spawn over periods of the full moon (Ref. 6390). Spawn throughout the year in tropical waters (Ref. 6390).
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thunnus obesus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 54 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCCTCTTTCCTTCTGCTTCTAGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTGGCCCACGCAGGGGCATCAGTTGACCTAACTATTTTCTCACTGCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGAGCTGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCTGGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCCGGATTCGGAATGATCTCCCACATTGTTGCCTACTACTCAGGTAAAAAAGAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATCGTATGAGCCCACCACATGTTCACGGTAGGAATGGACGTAGACACACGAGCATACTTTACATCCGCAACTATGATTATCGCAATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCAACCCTTCACGGAGGAGCTGTTAAGTGAGAAACCCCTCTGCTATGGGCCATTGGCTTTATTTTCCTCTTTACAGTTGGAGGGCTAACAGGTATTGTCCTAGCCAATTCATCTCTAGACATCGTTCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTACTATCTATGGGAGCTGTATTCGCCATTGTTGCCGCCTTCGTACACTGATTCCCACTATTTACAGGATATACCCTTCACAGCACATGAACTAAAATCCACTTCGGGGTAATGTTTGTAGGTGTCAATCTTACATTCTTCCCACAGCACTTCCTAGGACTAGCAGGAATGCCTCGACGGTATTCAGACTACCCAGACGCCTACACCCTTTGAAACACAATTTCCTCTATTGGATCCCTTATCTCCCTAGTAGCAGTAATTATGTTCCTATTTATTATTTGAGAAGCTTTCGCTGCCAAACGTGAAGTAATGTCAGTAGAACTAACTTCAACTAACGTTGAATGACTACACGGCTGCCCTCCGCCATACCACACATTCGAAGAGCCTGCATTCGTTCTAGTCCAATCAGACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus obesus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 63
Specimens with Barcodes: 86
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at National Institute of Water and Atmospheric Research, Wellington
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., Chiang, W., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Nelson, R., Oxenford, H., Restrepo, V., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is important in commercial fisheries around the world. It is being effectively managed throughout the majority of its range, with the exception of the Western and Central Pacific stock. With the exception of the Western Pacific population, all other stocks are being fished below current maximum sustainable yield (MSY). Based on weighted declines of total biomass or spawning stock biomass (SSB) across all stocks, there has been an estimated 42% decline globally over the past 15 years (1992–2007), or three generation lengths. As the MSY of the Western and Central Pacific stock represents more than 20% of the global population, this species is listed as Vulnerable under Criterion A2. In addition, this species may undergo further declines if the mortality of the species in bycatch of the Skipjack fishery cannot be reduced.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007. The Pacific stock is classified as Endangered (EN) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
FAO worldwide reported landings show a gradual increase from 808 tonnes in 1950 to an average of approximately 400,000–450,000 tonnes from 1996–2006 (FAO 2009). There are four stocks that are globally managed for this species. As of 2004, the stocks in the Atlantic and Indian Ocean are considered Fully Exploited, and the Eastern Pacific and Western/Central Pacific stocks are considered Over-exploited (Majkowski 2007). It is assumed that the Bigeye Tuna in the Eastern Pacific comprise a separate stock from the Western Pacific.

Eastern Pacific Ocean
In the Eastern Pacific, annual catches although fluctuating, average 100,000–130,000 tonnes and are increasing. The expansion of the purse seine fisheries in mid 1990s has contributed to this increase in landings (STECF 2007). The stock size in 1993 is estimated to have been 34% of its unexploited size. After 1993, purse seining for tunas associated with fish-aggregating devices (FADs) took significant quantities of small and medium-sized Bigeye Tuna. In 2005, after several years of poor recruitment and excessive levels of fishing mortality, the stock size was estimated to be at about 14% of its unexploited size. Due to recent spikes in recruitment, the current level has increased to 17% (IATTC 2008). Recent catches, such as in 2008, have been above the estimated maximum sustainable yield (MSY) of 84,000 tonnes (ISSF 2010).

Previous analyses indicated that the spawning stock biomass (SSB) was below MSY, and that fishing mortality rates were about 20% greater than those corresponding to the MSY (IATTC 2008, Aires da Silva and Maunder 2007), indicating that the Bigeye Tuna stock in the Eastern Pacific was over-exploited (IATTC 2008). However, according to the most recent stock assessment conducted in 2009 (Aires da Silva and Maunder 2010), fishing mortality rates are estimated to be below the level corresponding to MSY, and the recent levels of spawning biomass are estimated to be above that level (IATTC 2010). However, these results are more pessimistic if a stock-recruitment relationship is assumed, if a higher value is assumed for the average size of the older fish, if lower rates of natural mortality are assumed for adult Bigeye Tuna, and if only the late period of the fishery (1995–2009) is included in the assessment (IATTC 2010). In addition, La Niña events may become stronger and more frequent during the period 2010–2030, and this La Niña dominance may negatively influence recruitment strength of Bigeye Tuna in the Eastern Pacific Ocean (IATTC 2010).

Based on linear regression of SSB estimates from the most recent 2009 stock assessment (Aires da Silva and Maunder 2010), there has been an estimated 18% decline in SSB over the past 15 years (1992–2007) in the Eastern Pacific.

Western and Central Pacific Ocean
The overall trend in the Western Central Pacific Ocean is that biomass declined rapidly during the 1950s and 1960s, was relatively stable through the 1970s and 1980s, and then declined steadily from 1990 onwards (Langley et al. 2008). Adult biomass has declined by at least 20% over the last decade (STECF 2007, Langley et al. 2008). Fishing mortality has increased steadily since the introduction of commercial fishing. Current fishing mortality exceeds FMSY, and it was estimated that a 34–50% reduction from the level of fishing mortality in 2004–2007 would be needed to keep the biomass above the level corresponding to MSY (ISSF 2010). However, current bomass is also greater than BMSY. It was predicted that if fishing mortality continues at current levels, the biomass would be reduced to about half the MSY level (Harley et al. 2010, ISSF 2010).

Based on linear regression of SSB estimates from the most recent 2010 stock assessment (Harley et al. 2010), there has been an estimated 29% decline in SSB over the past 15 years (1992–2007) in the Western and Central Pacific. Currently, this stock is approaching an overfished state, if it is not already slightly overfished (Harley et al. 2010).

Indian Ocean
In previous assessment conducted in 2005 (Hillary and Mosquiera 2006), spawning stock biomass was estimated to have declined from approximately 180,000 tonnes to about 75,000 tonnes from 1954–2006, and given 2002 levels of fishing mortality and effort, was projected to decline to approximately 50,000 tonnes by 2014 (Hillary and Mosqueira 2006).

Results of an updated assessment conducted in 2009 based on various models (IOTC 2009), showed that results were broadly similar to previous work. Current (2008) exploitation levels for this stock (107,000 t) are within the range of estimated MSY levels (100,000–115,000 t), although catches in the past (1997–1999) have significantly exceeded MSY. Estimated values of fishing mortality and SSB for 2008 are also close to MSY-related values, indicating a fully exploited stock (IOTC 2009). Current spawning stock is estimated to be two billion individuals and 800,000 tonnes (IOTC 2009).

Based on linear regression of SSB estimates from the most recent 2009 stock assessment (IOTC 2009), there has been an estimated 73% decline in SSB over the past 15 years (1992–2007) in the Indian Ocean.

Atlantic Ocean
Genetic, tagging and fisheries data suggest this species constitutes a single interbreeding population in the Atlantic. The total catch for this species in the Atlantic increased up to the mid-1970s reaching 60,000 t and fluctuated over the next 15 years. In 1991, catch surpassed 95,000 t and continued to increase, reaching a historic high of about 133,000 t in 1994. Reported and estimated catch has been declining since then and fell below 100,000 t in 2001. This gradual decline in catch has continued, although with some fluctuations from year to year, until the most recent year of data 2009. The preliminary estimate for 2009 is 86,011 t, the highest value in the last five years. This estimate includes preliminary estimates made for a few fleets that have not yet provided data to ICCAT (SCRS ICCAT 2010).

In 2010, the plausible range of MSY estimated from the joint distribution using three types of abundance indices was between 78,700 and 101,600 tons (80% confidence limits) with a median MSY of 92,000 t. Historical estimates show large declines in biomass and increases in fishing mortality, especially in the mid 1990s when fishing mortality exceeded FMSY for several years. In the last five or six years there have been possible increases in biomass and declines in fishing mortality. The biomass at the beginning of 2010 was estimated to be at between 0.72 and 1.34 (80% confidence limits) of the biomass at MSY, with a median value of 1.01 and the 2009 fishing mortality rate was estimated to be between 0.65–1.55 (80% confidence limits) with a median of 0.95 (SCRS ICCAT 2010).

Based on linear regression of total biomass estimates from the most recent 2010 stock assessment (ICCAT 2010), there has been an estimated 40% decline in total biomass over the past 15 years (1992–2007) in the Atlantic Ocean.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Overfishing is occurring primarily in the Western Pacific, with adult biomass having declined about 20% over the past decade (Langley et al. 2008), and if fishing mortality continues at current levels, the biomass is predicted to reduce to about half the MSY level (Harley et al. 2010, ISSF 2010). In addition, this species may undergo further declines if the mortality of the species in bycatch of the Skipjack Tuna fishery cannot be reduced.

In the Pacific, Bigeye Tuna are primarily exploited by longliners from 40°N to 40°S and by purse seiners from 10°N to 20°S. In the Eastern Pacific Ocean there have been substantial changes in the Bigeye Tuna fishery over the last 15 years. Initially, the majority of the Bigeye Tuna catch was taken by longline vessels, but with the expansion of the fishery using fish-aggregating devices (FADs) since 1993, the purse seine fishery has taken an increasing proportion of the Bigeye Tuna catch. The FAD fishery captures smaller Bigeye Tuna, and has therefore reduced the yield per recruit and the maximum sustainable yield (MSY). On average, the fishing mortality of Bigeye Tuna less than four and a half years old has increased substantially since 1993, and that of older fish has increased slightly (IATTC 2008).

In the Indian Ocean, Bigeye Tuna is mainly caught by industrial purse seine and longline fisheries and appears only occasionally in the catches of other fisheries. However, in recent years the amounts of Bigeye Tuna caught by gillnet fisheries are likely to be considerably higher due to the major changes experienced in some of these fleets, notably changes in boat size, fishing techniques and fishing grounds. In recent years catches of Bigeye Tuna in the western Indian Ocean have dropped considerably, especially in areas off Somalia, Kenya and Tanzania and in particular in 2008 and, especially, 2009. The drop in catches is the consequence of a drop in fishing effort in the area of both purse seine and longline fisheries, due to the effect of piracy in the western Indian Ocean region, while catches are increasing in the eastern Indian Ocean probably due to the shift of some longline fleet in the areas because of the piracy activities along the Somalia area (IOTC 2010).

In the Atlantic this stock is exploited by three major gears/fisheries: longline (50–60%), purse seine (25%) and pole-and-line (15%) (ISSF 2010). Although there are a number of data uncertainties, including a lack of data on illegal, unregulated and unreported (IUU) fishing, stock assessment models estimate the MSY to be between 90,000-93,000 tonnes (ISSF 2010). Based on these projections, biomass is expected to rebuild to the MSY level in a few years if catches are maintained at or below 85,000 tonnes. It is important to note the use of high-tech FADs in the Gulf of Guinea and increases in effort due to vessels coming from the Indian Ocean, will increase already high levels of fishing mortality of juvenile Bigeye Tuna.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The bigeye tuna is an important target for fisheries in many parts of its range, and its flesh attracts high prices. All stocks of the bigeye tuna are now considered fully fished or over-fished, and overfishing is occurring in some areas, notably in the Endangered Pacific stock (5). The biological characteristics of the bigeye tuna, (it is relatively long-lived, late to spawn, and has a low productivity) make it more vulnerable to over-fishing than species such as skipjack tuna and yellowfin tuna. Without swift and effective management actions, populations of bigeye tuna are likely to go the same way as the Southern bluefin tuna (5), classified by the World Conservation Union (IUCN) as Critically Endangered (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed as a highly migratory species in Annex I of the 1982 Convention on the Law of the Sea (FAO Fisheries Department 1994).

In the Pacific, several countries such as Ecuador, Colombia and Peru have created closures for this species. The vast majority of the catch is from Ecuador in this region. SPC made a recommendation to reduce catches in the Pacific. In Taiwan, the fleet has been reduced by 183 Bigeye long-line vessels (which is more than 30% of fishing capacity) (IATTC 2008). As of December 2009, NOAA has put into place catch limits for US pelagic longline fisheries in Western and Central Pacific Ocean for 2009, 2010 and 2011 having determined that the Pacific Ocean population is subject to overfishing. Under this rule, the U.S. will reduce its longline catch of Bigeye Tuna from the 2004 baseline catch of 4,181 metric tons (mt) to 3,763 mt.

In the Atlantic, the Scientific, Technical and Economic Committee for Fisheries (STECF) recommends that the total catch does not exceed 85,000 t (STECF 2009). Recommendation 04-01 also implemented a new, smaller closure for the surface fishing in the area 0–5ºN, 10–20ºW during November in the Gulf of Guinea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In the Atlantic, Indian and Pacific oceans there are commissions responsible for the conservation and management of the bigeye tuna; the International Commission for the Conservation of Atlantic Tunas (ICCAT), the Indian Ocean Tuna Commission (IOTC), the Western and Central Pacific Fisheries Commission (WCPFC), and the Inter-American Tropical Tuna Commission (IATTC). However, a report by Traffic International and WWF Australia found that management of bigeye tuna stocks has been slow to respond to scientific advice, and have failed to initiate appropriate management measures. Unless this situation changes, all four bigeye tuna stocks will become overfished (5), and the collapse of bigeye tuna stocks would greatly impact many people reliant on the employment and income of the fishing, processing and trading industries (7). Hopefully more precautionary management measures will soon be implemented, before it is too late for this important and fascinating fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bigeye tuna

The bigeye tuna, Thunnus obesus, is an important food fish and prized recreational game fish. It is a true tuna of the genus Thunnus, belonging to the wider mackerel family Scombridae.

In Hawaiian, it is one of two species known as ʻahi; the other is yellowfin tuna.[2]

Contents

Range and habitat

Bigeye tuna are found in the open waters of all tropical and temperate oceans, but not the Mediterranean Sea.

Anatomy

Bigeye tuna vary up to 250 centimetres (98 in) in length. Its maximum weight probably exceeds 400 pounds (180 kg), with the all-tackle angling record standing at 392 pounds (178 kg). They are large, deep-bodied, streamlined fish with large heads and eyes. The pectoral fins are very long, reaching back as far as the second dorsal fin. They display 13 or 14 dorsal spines.

Physiology

The bigeye forages in cold and oxygen-poor subsurface waters. Their blood extracts oxygen efficiently even in oxygen-poor conditions. Their vision functions well in low light conditions. The heart has an unusual ability to function effectively while foraging in cold subsurface water. Nonetheless, they must periodically return to warmer surface waters to warm up.

Life history

Longer-lived than the closely related yellowfin tuna, the bigeye has a lifespan of up to 12 years, with sexual maturity at age four. Spawning takes place in June and July in the northwestern tropical Atlantic, and in January and February in the Gulf of Guinea, which is the only known Atlantic nursery area.

Satellite tagging showed that bigeye tuna often spend prolonged periods diving deep below the surface during the daytime, sometimes reaching 500 metres (1,600 ft). Bigeye have been tracked entering water as cold as 5 °C (41 °F). These movements are thought to be in response to vertical migrations of prey organisms in the deep scattering layer.

Feeding

Feed items include both epipelagic and mesopelagic species, with deep diving behaviour during the day thought to be related to the seeking of prey.

Fishery

Bigeye tuna caught with three-pole one-line rig.

Bigeye tuna are amongst the tuna species most threatened by overfishing. Juvenile bigeye tuna associate closely with floating objects such as logs, buoys and other flotsam, which makes them susceptible to purse seine fishing in conjunction with man-made fish aggregation devices. The removal of large numbers of juvenile bigeye, before they reach breeding age, is a major concern to fisheries managers, scientists and sport fishermen. Most seafood sustainability guides encourage consumption of other types of tuna.

In 2010, Greenpeace International has added the bigeye tuna to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[3]

Western and central Pacific

The central and western Pacific provides about 54 percent of the world's tuna, amounting to about 1.3 million tons annually.[4] For the first time ever, NOAA closed the western and central Pacific bigeye fishery to the Hawaii-based longline fishing fleet for the final three days of 2009, having reached the internationally-agreed catch limit of 3,673 metric tons (3,615 long tons). This limit is 30% lower than that of earlier years and will also apply to 2010. The ban does not apply to yellowfin tuna and other fishes or bigeye in the eastern Pacific.[5]

The United States and the eight island nations that are part of the so-called Nauru Agreement are negotiating an extension of the 1987 Multilateral Treaty, which allows the United States 40 vessels with no limit on fishing days. That treaty expires on 2013. The island nations want the U.S. to reduce the number of days its boats fish each year and lower quotas by 20-30%. Since 2004, quotas on longline fishing have reduced bigeye fishing by 10 percent.[4]

Hawaii's longline fishing vessels virtually stopped 2010 bigeye fishing in the central and western Pacific as of Nov. 22 after reaching their quota. They continued fishing in nontraditional waters in the eastern Pacific, where trips are longer and tuna may be scarce.[4]

The Western Pacific Regional Fishery Management Council acts as a policy adviser to the U.S. Secretary of Commerce. The council supports a reduction in the use of purse seine nets at fish aggregation devices—open-ocean buoys—because too many juvenile bigeyes are taken before they become sexually mature and can propagate.[4]

At a conference in April, Nauru countries banned purse seine fishing by vessels under license to the group in some high seas around their nations as of January. 1. That agreement covers an estimated 25 percent of the world's tuna catch.[4]

The "Nauru countries" are the Federated States of Micronesia, Kiribati, the Republic of the Marshall Islands, Nauru, the Republic of Palau, Papua New Guinea, Solomon Islands and Tuvalu. Other commission members include Australia, China, Canada, the Cook Islands, the European Union, Fiji, France, Japan, South Korea, New Zealand, Niue, the Philippines, Samoa, Taiwan, Tonga, the United States and Vanuatu.[4]

Notes

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!