Overview

Brief Summary

The bluefin tunas are among the largest and fastest open ocean fishes and are important economically and culturally in many parts of the world. There are three species of bluefin tuna- the prized and endangered Atlantic bluefin (Thunnus thynnus), the widespread but similarly overfished Pacific bluefin (Thunnus orientalis), and the smaller but also tasty Southern bluefin tuna (Thunnus mccoyi). Bluefin tunas are spectacular swimming machines with torpedo-shaped, streamlined bodies built for speed and high-powered muscle and tendon systems that have evolved for high endurance. Bluefin tunas are warm-blooded, a rare trait among fish, and are thus able to adjust their body temperature, keeping their body temperatures higher than the surrounding water, which is why they are so well adapted to cooler ocean waters.
Bluefin tunas are considered exceptionally good to eat, particularly by those who enjoy various forms of raw fish such as sushi and sashimi, and all species of bluefin tuna are pursued constantly by the fishing industry and by sport fishermen. As a result, overfishing throughout their range has driven their numbers to critically low levels. Some populations of bluefin tuna are thought be extinct and others are critically endangered.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Bluefin tuna spend their lives swimming constantly through the oceans cruising at 2 - 3km per hour (4), although they are able to reach speeds of 70 km per hour (5). Individuals swim together in shoals and these migrate vast distances from spawning grounds in the Indian Ocean to feeding grounds in colder southern waters (3). It is thought that females do not spawn until they reach around 1.5 metres in length, which corresponds to at least 8 years of age (4). A mature female will produce several million eggs in one spawning period (4). The breeding season runs from September and October until March (3), and occurs in Indonesian waters (4). Juveniles are then known to group together during the summer months in coastal waters off the southern coast of Australia until they reach around 5 years old, after which they are more consistently associated with deeper waters (4). These oceanic fish are opportunistic feeders, preying on a wide variety of other fish as well as crustaceans, cephalopods (such as squid and octopus) and other marine animals (6). Bluefin tuna are thought to be long-lived with a life expectancy possibly as long as 40 years (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The southern bluefin tuna is one of the largest bony fish in the world (2). The incredibly streamlined and powerful body is deepest near the middle of the first dorsal fin (3) and tapers to a pointed snout (2). The lower half of the body is silvery white, whilst the anal fin is a dusky yellow colour (3). The tail is crescent-shaped (2) and the first dorsal fin has a yellow or blueish hue (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

By maturity, most southern bluefin tuna lead an oceanic, pelagic existence (Ref. 6390). Spawning fish and larvae are encountered in waters with surface temperatures between 20° and 30°C. An opportunistic feeder, preying on a wide variety of fishes, crustaceans, cephalopods, salps, and other marine animals. Mostly canned (Ref. 9684). A specialized fishery for sashimi-quality has been developed recently by New Zealand fishers. In Japan, it is highly prized for the sashimi markets.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Pacific: Philippines and southern Okhotsk Sea east to Eastern Pacific from Gulf of Alaska to California (U. S. A.), south to Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Indian and Pacific: temperate and cold seas, mainly between 30°S and 50°S, to nearly 60°S. During spawning, large fish migrate to tropical seas, off the west coast of Australia, up to 10°S. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139). If the current exploitation continues, the population will be below 500 mature individuals in 100 years (Ref. 27905).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Madagascar, New Zealand Exclusive Economic Zone, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern Ocean south of 30°S, except moving to northwestern Australia for spawning.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found throughout the southern oceans, mainly between 30 and 50° South. Breeding takes place just southeast of the island of Java, Indonesia (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3000 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 2450 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

245 cm FL (male/unsexed; (Ref. 5203)); max. published weight: 260.0 kg (Ref. 5203); max. reported age: 20 years (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A very large species, deepest near the middle of the first dorsal fin base. Swim bladder present. Lower sides and belly silvery white with colorless transverse lines alternating with rows of colorless dots. The first dorsal fin is yellow or bluish; the anal fin and finlets are dusky yellow edged with black; the median caudal keel is yellow in adults.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Confined to temperatures between 5° and 20°C for much of its life span. Spawning fish and larvae, however, are encountered in waters with surface temperatures between 20° and 30°C. An opportunistic feeder, preying on a wide variety of fishes, crustaceans, cephalopods, salps, and other marine animals. Canning is the most important form of local utilization of this highly esteemed fish (Ref. 9684). A specialized fishery for sashimi-quality has been developed recently by New Zealand fishermen. In Japan, it is highly prized for the sashimi markets.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 50 - 2743 m (Ref. 57178)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
By maturity, most Southern Bluefin Tuna lead an oceanic, pelagic existence. Spawning fish and larvae are encountered in waters with surface temperatures between 20 and 30°C. This species is an opportunistic feeder, preying on a wide variety of fishes, crustaceans, cephalopods, salps, and other marine animals.

Maximum size is 225 cm fork length (FL) and 200 kg. Longevity is 20 or more years. Sex ratio in catches shows that as juveniles, females outnumber males but this situation is reversed in adults. Maturity can occur at 120 cm (FL) but more commonly at 130 cm or about eight years old; size at 50% maturity has also been estimated to be 152 cm (FL) (Collette and Nauen 1983, Thorogood 1986, Caton 1994, Farley and Davis 1998, Schaefer 2001, Collette 2010). Based on the CCSBT (CCSBT 2009, CCSBT 2010), age of first maturity is estimated to be about 10 years and longevity about 40 years. Generation length is therefore very conservatively estimated to be at least 12 years.

Spawning is restricted to a relatively small area off northwestern Australia in the eastern tropical Indian Ocean (Nishikawa et al. 1985). The spawning season extends throughout the southern summer from about September or October to March at water surface temperatures in excess of 24°C. Once females start spawning, they appear to spawn daily. The Southern Bluefin is an asynchronous indeterminate spawner with annual batch fecundity 57 oocytes/g body weight. Fecundity of a 158 cm female with gonads weighing about 1.7 kg each was estimated at about 14–15 million eggs (Thorogood 1986, Caton 1994, Farley and Davis 1998, Schaefer 2001, Collette 2010). It is not known whether all mature fish spawn each year, every few years, or even only once in their lifetime.

In Australia, Southern Bluefin Tuna migrate along the west coast and across the Great Australian Bight and around Tasmania to 45°S, and then along the southeastern Australian coastline to about 30°S, off northern New South Wales.

The all-tackle game fish record is of a 167.5 kg fish caught off Tatra, Australia in 2009 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 462.5 - 2743.2
  Temperature range (°C): 6.855 - 6.855
  Nitrate (umol/L): 18.351 - 18.351
  Salinity (PPS): 34.368 - 34.368
  Oxygen (ml/l): 6.230 - 6.230
  Phosphate (umol/l): 1.264 - 1.264
  Silicate (umol/l): 8.219 - 8.219

Graphical representation

Depth range (m): 462.5 - 2743.2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is pelagic, inhabiting the open oceans mainly in cold temperate waters (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

In adults, seasonal migrations are observed between the warm water western and northwestern Australian spawning grounds and cold water feeding grounds off Tasmania and New Zealand (at temperatures of 13° to 15°C). The migration pattern of these tuna is revealed by the capture of progressively larger fish along the migration route (Ref. 6390). Juveniles 6-8 cm long have been collected on the North West Shelf of Austrlia and larger juveniles (20-60 cm FL) have been caught on the continental shelf further south (22-34°S) (Ref. 30319).Young fish are generally closely associated with coastal and continental shelf waters, although some immature fish, from 3 years of age, move away from the shelf to feed in the waters of the West Wind Drift (40-45°S) of the Southern Ocean (Ref. 30318). They are caught by longline as far away as South Africa (Ref. 6390). By maturity, most southern bluefin tuna lead an oceanic, pelagic existence (Ref. 6390).Feed on fish and benthic invertebrates (Ref. 168).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Syncoelium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhadinorhycyus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pterobothrium Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nybelinia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neohexostoma Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kudoa Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 11. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Colocyntotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cetiotrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cardicola Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Capsularia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Callitetrarhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 21. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brachiella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benedenia Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

It is not known whether all mature fish spawn each year, every few years, or even only once in their lifetime (Ref. 30320).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Efficient propulsion system: bluefin tuna
 

Tails of bluefin tuna conserve energy by using thunniform swimming.

   
 
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Fins provide streamlined shape: tuna
 

Fins of ocean-going fish such as tuna are streamlined because they fit close to the body in depressions and grooves when not needed.

       
  [Referring to high-speed ocean-going fish such as tuna, bonito, marlin, and mackerel] "The pectoral and pelvic fins and the dorsal along the crest of the back play no part in propulsion. They serve only as rudders, stabilisers or brakes. When the fish is moving at speed and they are not required they are clamped to the fish's side, fitting exactly into depressions and grooves on the surface. And along the top and bottom edge of the body, on either side of the tail, are tiny triangular blades that serve as spoilers to prevent turbulence." (Attenborough 1979:120)
  Learn more about this functional adaptation.
  • Attenborough, D. 1979. Life on earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thunnus maccoyii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATGATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCCTCTTTCCTTCTGCTCCTAGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTATCCTCCCCTTGCCGGCAACCTAGCCCACGCAGGGGCATCAGTTGACCTAACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGGGCTGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCTGGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGGCATCCAGAAGTCTACATTCTTATTCTTCCTGGATTCGGAATGATCTCCCACATTGTTGCCTACTACTCAGGTAAAAAAGAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATCGTATGAGCCCATCACATGTTCACGGTAGGAATGGACGTAGACACACGGGCATACTTTACATCCGCAACTATGATTATCGCAATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCAACCCTTCACGGAGGAGCTGTTAAGTGAGAAACCCCTCTGCTATGAGCCATTGGCTTTATTTTCCTCTTTACAGTCGGAGGGCTAACAGGTATCGTCCTGGCCAATTCATCTCTAGACATCGTTCTACACGACACCTACTACGTAGTAGCCCACTTCCACTACGTACTATCTATGGGAGCTGTATTCGCCATTGTTGCCGCCTTCGTACACTGATTCCCACTATTCACAGGATACACCCTTCACAGCACATGAACTAAAATCCACTTCGGAGTAATGTTTGTAGGTGTCAACCTTACATTCTTCCCACAGCACTTCCTAGGACTAGCAGGAATGCCTCGACGGTATTCAGACTACCCAGACGCCTACACCCTTTGAAACACAATTTCCTCTATTGGATCCCTTATCTCCCTAGTAGCAGTAATTATGTTCCTATTTATTATTTGAGAAGCTTTCGCTGCCAAACGTGAAGTAATGTCAGTAGAACTAACTTCAACTAACGTTGAATGACTACACGGCTGCCCTCCGCCATACCACACATTCGAAGAGCCTGCATTCGTTCTAGTCCAATCAGACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus maccoyii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bd

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Chang, S.-K., Di Natale, A., Fox, W., Juan Jorda, M., Miyabe, N., Nelson, R., Uozumi, Y. & Wang, S.

Reviewer/s
Russell, B., Carpenter, K.E. & Polidoro, B.

Contributor/s

Justification
This species has been intensively fished since the early 1950s. Its generation length is conservatively estimated to be 12 years. Estimated spawning stock biomass has declined approximately 85% over the past 36 years (1973–2009) and there is no sign that the spawning stock is rebuilding. It is therefore listed as Critically Endangered. Implementation of effective conservation and management measures are urgently needed.

History
  • 1996
    Critically Endangered
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR - A1bd) on the IUCN Red List 2002 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Worldwide reported landings show a gradual, but variable, increase from 13,552 tonnes in 1952 to a high of 55,200 tonnes in 1969, and then gradually decreasing, to 12,122 tonnes in 1991. Catches from 1992 to 2006 have been relatively stable, averaging around 16,0000 tonnes per year (FAO 2009). This species is farmed in Australia, where mostly immature fish (age 2–4 years) are removed from the wild and fattened in farms. This complicates estimation of catches and is associated with high mortality rates of fish during transport.

A stock assessment has been carried out by the Commission for the Conservation of Southern Bluefin Tuna (CCSBT 2006). Based on the median results of this most recent stock assessment, there has been an estimated 85.4% decline in spawning stock biomass over the past 36 years from 1973 to 2009 (CCSBT 2010).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species has been intensively fished since the 1950s, primarily being taken on longlines, and the dramatic decline in the total population of Southern Bluefin Tuna to 7–15% of the 1960 parental biomass is well documented (FSC 2009). Canning was the most important form of local utilization of this highly esteemed fish until the early 1980s. This species is considered depleted by Majkowski (2007), and seriously overfished by Joseph (2009). If the current exploitation continues, it is estimated that the population will be below 500 mature individuals in 100 years. According the most recent stock assessment, there is no current sign that the spawning stock of this species is rebuilding (CCSBT 2009, CCSBT 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The southern bluefin tuna has been heavily exploited over the years and has been fished to the brink of extinction (5). During the 1960s, the annual catch was around 80,000 tonnes worldwide (4). The flesh of this species has a particularly high fat content and is prized in Japan especially for 'sashimi' markets (4), where an individual fish can fetch as much as US$ 10,000 (3). Fishing mainly takes the form of purse seine netting in Australia (5), and longline fishing in the other range states; namely New Zealand, Japan, the Republic of Korea, Taiwan and Indonesia (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This is a highly migratory species, listed in Annex I of the 1982 Convention on the Law of the Sea. Current worldwide catch quota has been reduced to 9,448 tonnes per year (CCSBT 2009). However, the current fishing capacity is much higher than the quota. There are several management measures in place including catch control, vessel monitoring, etc. However, more restrictions may be needed.

The CCSBT agreed that the status of the stock is at a critical stage and that a meaningful reduction in the total allowable catch (TAC) is necessary in order to recover the stock and work toward reaching an interim rebuilding target reference point of 20% of the original spawning stock. Consequently, the CCSBT reduced the global total allowable catch (TAC) for 2010 and 2011 to an average level over the two years of 80% of the previously allocated global TAC of 11,810 tonnes. Accordingly, the average global TAC for each of the 2010 and 2011 fishing seasons will be 9,449 tonnes.

The CCSBT has adopted a number of conservation measures including requirements for fleets to monitor and submit data to show compliance with TACs, development of scientific observer programs, monitoring of farming operations and port inspection of catches. The CCSBT has also implemented a Trade Information Scheme to collect more accurate and comprehensive data on Southern Bluefin Tuna fishing by monitoring trade and illegal, unregulated and unreported fishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1994, Australia, Japan and New Zealand signed the Convention for the Conservation of Southern Bluefin Tuna in an attempt to curb the overfishing of this species (4). The Commission for the Conservation of the Southern Bluefin Tuna (CCSBT) has subsequently formed and in 2001, was joined by the Republic of Korea (4). The objective of the Commission is to ensure the conservation and optimum utilisation of the global southern bluefin tuna fishery, through management measures including reduced fishing quotas and research (4). Some scientists and conservationists are worried, however, that the Commission does not go far enough, and that global breeding stocks, having been reduced by as much as 97%, will require more drastic measures if they are ever to recover (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern bluefin tuna

The southern bluefin tuna, Thunnus maccoyii, is a tuna of the family Scombridae found in open southern hemisphere waters of all the world's oceans mainly between 30°S and 50°S, to nearly 60°S. At up to 2.5 m (8.2 ft) and weighing up to 400 kg (882 lbs) it is among the larger bony fishes.

The southern bluefin tuna is a large, streamlined, fast swimming fish with a long, slender caudal peduncle and relatively short dorsal, pectoral and anal fins. The body is completely covered in small scales.

The body color is blue-black on the back and silver-white on the flanks and belly, with bright yellow caudal keels in adult specimens. The first dorsal fin colour is grey with a yellow tinge, the second dorsal is red-brown, and the finlets are yellow with a darker border.

Southern bluefin tuna, like other pelagic tuna species, are part of a group of bony fishes that can maintain their body core temperature up to 10 degrees above the ambient temperature. This advantage enables them to maintain high metabolic output for predation and migrating large distances. The southern bluefin tuna is an opportunistic feeder, preying on a wide variety of fish, crustaceans, cephalopods, salps, and other marine animals.

Contents

Harvesting

The onset of industrial fishing in the 1950s, in conjunction with ever improving technologies such as GPS, fishfinders, satellite imagery, etc., and the knowledge of migration routes, has led to the exploitation of southern bluefin tuna across its entire range. Improved refrigeration techniques and a demanding global market saw global SBT catch plummet from 80,000 tonnes a year during the 1960s to 40,000 tonnes a year by 1980.[2] Australian catch peaked in 1982 at 21,500 tonnes, and the total population of SBT has since declined by about 92 percent.[3]

Conservation

The southern bluefin tuna is now classified as Critically Endangered on the IUCN Red List of Threatened species.[1] In 2010, Greenpeace International has added the SBT to its seafood red list. The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which Greenpeace believe have a very high risk of being sourced from unsustainable fisheries.[4]

There was a pressing obligation to alleviate some of the harvesting pressure on SBT populations, and increasing concerns about sustainability in the mid 1980s led the main nations fishing SBT at the time to manage catches. These nations imposed strict quotas to their fishing fleets, although no official quotas were put in place.

In 1994, the then existing voluntary management arrangement between Australia, Japan and New Zealand was formalised when the Convention for the Conservation of Southern Bluefin Tuna came into force. The Convention created the Commission for the Conservation of Southern Bluefin Tuna (CCSBT). Its objective was to ensure, through appropriate management, the conservation and optimum utilisation of the global SBT fishery. South Korea, Taiwan and Indonesia have since joined or are cooperating with the Commission. The CCSBT is headquartered in Canberra, Australia.

Current quota limits reflect the vulnerable nature of wild stocks, with quotas being reduced for the 2010/2011 seasons to 80% of years previous. Thus the global total allowable catch (TAC) has been reduced from 11,810 tonnes from the previously allocated global TAC to 9,449 tonnes.[5] Australia currently has the highest "effective catch limit" with 4,015 tonnes, followed by Japan (2,261), Republic of Korea (859), Fishing Entity of Taiwan (859), New Zealand (709), and Indonesia (651).[5] However, fishing pressure outside the allocated global TAC is still a major concern for instance, the Australian government stated in 2006 that Japan had admitted to taking more than 100,000 tonnes over its quota; the new quotas reflect this, as Japans was cut by half, as supposed punishment for overfishing.

The quota system has actually increased the value of the catch, where fisherman that once earned $600 a ton selling fish to canneries began making more than $1,000 per ton of fish, selling them to buyers for the Japanese market. The quotas are expensive and are bought and sold like stocks within their national allocations.[6]

Aquaculture

Ranching

The rapidly declining fishery led to Australian tuna fishers investigating the potential for value-adding their catch through aquaculture. All SBT ranching occurs in a small region offshore of Port Lincoln, South Australia; the region comprising almost all of the SBT fishing companies in Australia since the 1970s.[7] This industry was initiated in 1991 and has now developed to be the largest farmed seafood sector in Australia.[7]

Southern Bluefin Tuna spawn between September and April each year in the only known spawning grounds in the Indian Ocean, between the north-west Coast of Australia and Indonesia. The eggs are estimated to hatch within two to three days, and over the next two years attain sizes of approximately 15 kilograms; this size is the principal wild catch of the Australian SBT industry. It is thought that SBT become sexually mature between 9 and 12 years in the wild,[7] which highlights the major negative impact of removing pre-spawning populations from the wild.

Juvenile tuna are mainly caught on the continental shelf in the Great Australian Bight region from December to around April each year, and as mentioned weigh on average 15 kilograms. The tuna that are located are purse seined, and then transferred through underwater panels between nets to specialised tow pontoons. They are then towed back to farm areas adjacent to Port Lincoln at a rate of about 1 knot; this process can take several weeks. Once back at the farm sites, the tuna are transferred from the tow pontoons into 40–50 m diameter farm pontoons. They are then fed bait fish (usually a range of locally caught or imported small pelagic species such as sardines) six days per week, twice per day and "grown out" for three to eight months, reaching an average of 30 to 40 kilograms.[2][7] Because SBT swim so fast and are used to migrating long distances, they are difficult to keep in small pens. Their delicate skin can be easily damaged if touched by human hands and too much handling can be fatal.

As with most aquaculture ventures, feeds are the biggest factor in the cost-efficiency of the farming operation, and there would be considerable advantages in using formulated pellet feed to supplement or replace the baitfish. However, as yet the manufactured feeds are not competitive with the baitfish.[8]

A further future prospect in enhancing the ranching of SBT is the plan of Long Term Holding. By holding its fish for two successive growing seasons (18 months) instead of one (up to 8 months), the industry could potentially achieve a major increase in volume, greater production from the limited quota of wild-caught juveniles, and ability to serve the market year round.[8] Undoubtedly, this presents several uncertainties, and is still in the planning stage.

At harvest time, the fish are gently guided into a boat (any bruising lowers the price) and killed and flash frozen and predominantly put on Tokyo-bound planes. They are so valuable, that armed guards are paid to watch over them; 2,000 tuna kept in a single pen are worth around $2 million.[6] Australia exports 10,000 metric tons of bluefin worth $200 million; almost all is from penned stocks.[6]

Complete aquaculture

Initially, the notorious difficulties in closing the life cycle of this species dissuaded most from farming them. However, in 2007, using hormonal therapy developed in Europe[9] and Japan (where they had already succeeded in breeding Northern Pacific bluefin tuna to third generation[10]) to mimic the natural production of hormones by wild fish, researchers in Australia managed for the first time to coax the species to breed in landlocked tanks. This was done by the Australian aquaculture company, Clean Seas Tuna Limited.[11] who collected its first batch of fertilized eggs from a breeding stock of about 20 tuna weighing 160 kilograms.[6] They were also the first company in the world to successfully transfer large SBT over large distances to its onshore facilities in Arno Bay which is where the spawning has taken place. This led Time magazine to award it second place in the 'World's Best Invention' of 2009.[12]

The state-of-the-art Arno Bay hatchery was purchased in 2000, and undertook a $2.5 million upgrade, where initial broodstock facilities catered for Kingfish (Seriola lalandi) and Mulloway (Argyrosomus japonicas), along with a live-feed production plant. This facility has more recently been upgraded to a $6.5 million special purpose SBT larval rearing recirculation facility. During the most recent summer (2009/2010), the company completed its third consecutive annual on-shore Southern Bluefin Tuna spawning program, having doubled the controlled spawning period to three months at its Arno Bay facility.[13] Fingerlings are now up to 40 days old with the grow-out program, and the spawning period has been extended from 6 weeks to 12, but as yet, grow-out of commercial quantities of SBT fingerlings has been unsuccessful.[13] Whilst aquaculture pioneers Clean Seas Limited have not been able to grow out commercial quantities of SBT fingerlings from this season's trials, the SBT broodstock are now being wintered and conditioned for the 2010-11 summer production run.[13]

With collaboration secured with International Researchers, in particular with Kinki University in Japan,[13] commercial viability is likely to be achieved in the near future. The successful closing of the SBT life cycle by Clean Seas will therefore potentially produce unrestricted additional tonnages of this valuable fish; supplying the growing global demand for SBT.

Enhancing growth and production

Feeds

Scientists are currently trying to develop less expensive fish feed. One of main obstacles is creating a processed food that doesn't affect the taste of the tuna because what a tuna eats very much affects the taste of its meat. As previously mentioned, SBT are still largely fed fresh or frozen small pelagic fishes, and the use of formulated pellets is not yet viable.[8] This cost is largely due to the expensive diet research costs (the annual costs of diet for research alone is approximately US$100,000[14]), and the problems associated with working with such large, mobile marine animals. Farm raised tuna generally have a higher fat content than wild tuna. A one metre tuna needs about 15 kilograms of live fish to put on one kilogram of fat, and about 1.5 to 2 tons of squid and mackerel are needed to produce a 100 kilogram bluefin tuna.[6] More research must be undertaken in evaluating the ingredients for use in SBT feed, and important information on ingredient digestibility, palatability and nutrient utilisation and interference can improve cost efficiencies.[15]

Dietary supplements

The use of dietary supplements can improve the shelf life of farmed SBT flesh. Results of a study by SARDI (South Australian Research and Development Institute) indicated that feeding a diet approximately 10 times higher in dietary antioxidants raised levels of vitamin E and vitamin C, but not selenium, in tuna flesh and increased the shelf life of tuna.[16] This is important as the frozen baitfish diets are likely to be lower in antioxidant vitamins than the wild tuna diet.

Parasites and pathology

So far the risk of parasite and disease spreading for SBT aquaculture is low to negligible; the modern SBT aquaculture industry has total catch to harvest mortalities of around 2-4%.[17] A diverse range of parasite species has been found hosting the SBT, with most of the parasites examined posing little or no risk to the health of the farms - with some SBT actually showing antibody responses to epizootics[18] - however, blood fluke and gill fluke have the greatest risk factors.[19][20] Hypoxia is also a significant issue, and can be escalated due to unforeseen environmental factors such as algal blooms.[17] So it seems that pathological risks are low now, however, this is seen as a dynamic process, therefore ongoing monitoring should take place to ensure its control, especially if farming intensifies and stocking levels increase.

Negative impacts

Sustainability is the key issue here, and with feed conversion ratios (feed to tuna growth) of approximately 10:1 or higher, though this is purely a consequence of the carnivorous diet and high metabolic costs of the species. Removing tuna from the wild before they have spawned is another obvious impact, which hopefully the closed life cycles of SBT at Clean Seas will alleviate some of the pressure on declining stocks. Tuna farms are point sources of solid waste onto to the benthos and dissolved nutrients into the water column. Most farms are more than a kilometre off the coast, thus the deeper water and significant currents alleviate some of the impact on the benthos. Due to the high metabolic rates of SBT, low retention rates of nitrogen in tissue is seen, and there are high environmental leaching of nutrients (86-92%).[17]

Other environmental impacts include the use of chemicals on the farms, which can leach into the surrounding environment. These include antifoulants to keep the cages free from colonial algae and animals, and therapeutants to deal with disease and parasitism. Toxicants, such as mercury and PCBs (polychlorinated biphenyls), can build up over time, particularly through the tuna feed, with some evidence of contaminants being more elevated in farmed fish than in wild stocks.[21]

Flesh

Southern Bluefin Tuna is a gourmet food, which is in demand for use in sashimi and sushi. It has medium flavoured flesh and is regarded by both Japanese and Western chefs as the best raw fish to eat in the world.[2]

Market

By far the largest consumer of SBT is Japan, with USA coming in second, followed by China. Japanese imports of fresh bluefin tuna (all 3 species) worldwide increased from 957 tons in 1984 to 5,235 tons in 1993 [7].[full citation needed] The price peaked in 1990 at $34 per kilogram when a typical 350 pound fish sold for around $10,000.[2] As of 2008, bluefin was selling for $23 a kilogram.[2] The drop in value was due to the drop in the Japanese market, an increase in supply from northern bluefin tuna from the Mediterranean, and more and more tuna being stored (tuna frozen with the special "flash" method can be kept for up to a year with no perceivable change in taste).

The Tsukiji Market in Tokyo is the largest wholesale market of SBT in the world. Tsukiji handles more than 2,400 tons of fish, worth about US$20 million, a day, with pre-dawn auctions of tuna being the main feature.[22] No tourists are allowed to enter the tuna wholesale areas, which they say is for purposes of sanitation and disruption to the auction process.[23] Higher prices are charged for the highest quality fish; bluefin tuna worth over $150,000 have been sold at Tsukiji. In 2001, a 202-kilogram wild tuna caught in Tsugaru Straight near Omanachi I Aomori Prefecture sold for $173,600, or about $800 a kilogram.[2]

References

  1. ^ a b Collette, B., Chang, S.-K., Di Natale, A., Fox, W., Juan Jorda, M., Miyabe, N., Nelson, R., Uozumi, Y. & Wang, S. (2011). "Thunnus maccoyii". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21858. Retrieved 12 January 2012.
  2. ^ a b c d e f Clean Seas Southern Bluefin Tuna: Sustainable Luxury
  3. ^ Japan's Sacred Bluefin, Loved Too Much
  4. ^ Greenpeace International Seafood Red List
  5. ^ a b Commission for the Conservation of Southern Bluefin Tuna
  6. ^ a b c d e Bluefin Tuna Fishing and Japan
  7. ^ a b c d Australian Seafood Cooperative Research Centre
  8. ^ a b c Australian Aquaculture and Finfish Cooperative Research Centre: Achievements Booklet
  9. ^ European breakthrough on bluefin tuna boosts Clean Seas’ artificial breeding regime
  10. ^ Fisheries Laboratory, Kinki University
  11. ^ Schuller K, Korte A, Crane M, & Williams A (2006). Immortal tuna created. Australasian Science, vol. June 2006, p. 9
  12. ^ Time Top 50 Scientific Discoveries
  13. ^ a b c d Clean Seas double SBT spawning period
  14. ^ Glencross B, Carter C, Gunn J, van Barneveld R, Rough K & Clarke S (2002). Southern Bluefin tuna, Thunnus maccoyii, In 'Nutrient Requirments and Feeding of Finfish for Aquaculture’, CAB International. 159-171
  15. ^ Glencross BD Booth M, & Allan GL (2007). A feed is only as good as its ingredients – a review of ingredient evaluation strategies for aquaculture feeds. Aquaculture Nutrition, vol. 13, 17-34
  16. ^ Buchanan J & Thomas P (2008). Improving the colour shelf life of farmed southern bluefin tuna (Thunnus maccoyii) flesh with dietary supplements of vitamins E and C and selenium. Journal of Aquatic Food Product Technology, vol. 17, 285-302
  17. ^ a b c Nowak B (2003) Assessment of health risks to southern bluefin tuna under current culture conditions. Bulletin of European Association of Fish Pathologists, vol. 24, 45-51
  18. ^ Aiken H, Hayward C, Crosbie P, Watts M & Nowak B (2008) Serological evidence of an immune response in farmed southern bluefin tuna against blood fluke infection: Development of an indirect enzyme-linked immunosorbent assay. Fish and Shellfish Immunology, vol. 25, 66-75
  19. ^ Fernandes M, Lauer P, Cheshire A & Angove M (2007). Preliminary model of nitrogen loads from Southern Bluefin Tuna Aquaculture. Marine Pollution Bulletin, vol. 54, issue 9, 1321-1332
  20. ^ Deveney MR, Bayly JT, Johnston CT & Nowak BF (2005) A parasite survey of farmed southern bluefin tuna (Thunnus maccoyii Castelnau). Journal of Fish Diseases, vol. 28, 279-284
  21. ^ Easton MDL, Luszniak D, Von der Geest E 2002. Preliminary examination of contaminant loadings in farmed salmon, wild salmon and commercial salmon feed. Chemosphere 46:1053-1074
  22. ^ Daito Gyorui Tuna Wholesalers
  23. ^ Tsukiji Fish Market
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!