Overview

Comprehensive Description

Biology

Found over hard, open bottoms at the bases of reefs and over sand and rubble patches (Ref. 1602); also observed in deep coastal to outer reef drops-offs subject to strong currents (Ref. 48637). Often in pairs (Ref. 1602). Monogamous (Ref. 52884). Feeds on zooplankton, especially copepods and crustacean larvae. Darts into a hole when alarmed (Ref. 1602). Minimum depth reported from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Mauritius to Samoa, north to Ryukyu Islands, south to New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mauritius
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: Réunion and Mauritius (western Mascarenes) east to Pohnpei (Micronesia) and Samoa, north to Ryukyu Islands and Taiwan, south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 27 - 32; Analspines: 1; Analsoft rays: 28 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 90 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found over hard, open bottoms at the bases of reefs and over sand and rubble patches (Ref. 1602). Often in pairs (Ref. 1602). Feeds on zooplankton, especially copepods and crustacean larvae. Darts into a hole when alarmed (Ref. 1602).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Nemateleotris decora Randall & Allen
Catalog Number: USNM 209307
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Allen & W. Starck
Year Collected: 1972
Locality: Palau Island; Augulupelu Reef, Palau Islands, Palau, Caroline Islands, Pacific
Depth (m): 46 to 46
  • Paratype: Randall, J. E. & Allen, G. R. 1973. Quarterly Journal of the Taiwan Museum. 26 (3-4): 347-36.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 25 - 70 m (Ref. 1602), usually 25 - 70 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 25 - 70m.
From 25 to 70 meters.

Habitat: reef-associated. Found over hard, open bottoms at the bases of reefs and over sand and rubble patches (Ref. 1602). Often in pairs (Ref. 1602). Feeds on zooplankton, especially copepods and crustacean larvae. Darts into a hole when alarmed (Ref. 1602). Occurs from the Ryukyu Islands to the Great Barrier Reef and west to the Maldives and Mauritius.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found over hard, open bottoms at the bases of reefs and over sand and rubble patches. Feeds on zooplankton, especially copepods and crustacean larvae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nemateleotris decora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAGTATTTGGTGCTTGGGCCGGCATGGTAGGCACGGCTCTAAGTCTGCTCATTCGGGCGGAGCTTAGCCAGCCAGGCGCCCTACTAGGGGACGACCAGATCTACAACGTAATCGTCACTGCTCACGCATTCGTGATGATTTTCTTTATAGTAATGCCAATTATGATTGGGGGTTTCGGAAACTGACTTGTACCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTTCTCCCTCCGTCCTTCCTGCTTCTGCTTGCTTCTTCCGGGGTTGAAGCCGGCGCCGGAACAGGGTGAACAGTTTACCCCCCTCTGGCGGGTAACTTAGCTCACGCCGGAGCCTCAGTAGACCTAACAATCTTCTCTCTTCACTTAGCGGGTATCTCCTCAATTTTAGGAGCAATTAATTTCATCACCACCATCCTAAACATGAAACCTCCCGCCATTTCACAGTATCAAACCCCTCTGTTCGTATGAGCAGTCCTAATTACAGCCGTTCTTCTACTTCTATCACTGCCAGTACTCGCCGCAGGTATTACGATGCTCCTAACAGATCGTAACCTAAACACAACCTTCTTCGACCCTGCGGGGGGAGGAGACCCAATCCTTTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nemateleotris decora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Elegant firefish

The elegant firefish or purple firefish, Nemateleotris decora, is a dartfish of the genus Nemateleotris.

This species is found in the Indo-West Pacific, from Mauritius to Samoa, north to Ryukyu Islands, and south to New Caledonia, from 25–70 metres ( ft) in depth. It is found over hard, open bottoms of reefs and sandy patches, as well as deeper coastal outer reef drop-offs.[1] It reaches a maximum length of 9 centimetres (3 in).[1] This species is often found in pairs and is monogamous.[1] These fish feed on zooplankton, especially copepods and crustacean larvae.[1] They will dart into holes when alarmed.[1]

In the aquarium

This fish is popular in reef aquariums and is resistant to diseases. These fish are relatively docile and will not attack tankmates where kept in a suitably sized aquarium; however, if kept in confined quarters these fish may squabble over territory.[2] Firefish are commonly kept in nano reef aquariums.

Firefish are prolific leapers. Thus, an aquarist contemplating the acquisition of either of these species should be certain that the aquarium hood will not easily allow the firefish to leap from the tank and expire. These fish should also be provided with rockwork to hide in.[2]

This and other species of firefish are occasionally spawned in captivity. [3]

References

  1. ^ a b c d e Froese, Rainer, and Daniel Pauly, eds. (2007). "Nemateleotris decora" in FishBase. Apr 2007 version.
  2. ^ a b Dakin, Nick (1992). The Macmillan book of the Marine Aquarium. New York: Macmillan Publishing Company. p. 225. ISBN 0-02-897108-6.
  3. ^ "Purple firefish FAQ". AquaDaily. 2009-02-09. http://aquadaily.com/2009/02/09/purple-firefish-faq/. Retrieved 2009-02-10.
  • Michael, Scott W. Marine Fishes. Neptune City, NJ: T.F.H. Publications, 2001. 360.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!