Overview

Comprehensive Description

Description

  Common names: pike-blenny (English), trambollín-lucio (Espanol), tubícola (Espanol)
 
Chaenopsis alepidota (Gilbert, 1890)


Orange-throat pike-blenny


Body very elongate; head long; no cirri on head; snout long & strongly pointed; long mouth, usually reaching far behind eye, tip of lower jaw projecting; first 3 mandibular pores (counting from front of jaw) equally spaced; at least a few teeth on front of roof of mouth, tip of tongue extends forward at least as far as those teeth; dorsal fin XVIII-XX, 34-36, front half of fin moderately elevated in adult males;  anal rays II, 34-37; pectoral rays 12-13; tail fin rounded, joined to dorsal and anal fins.

Pale green with a longitudinal row of white spots along mid-sde and another along base of the dorsal fin; 8-10 dark brown to green bars usually evident on side; male  with black dorsal fin; blue-grey belly; blue-grey spots on body; black chin and throat and an orange stripe from the rear of the mouth across the operculum.


Size: to 15 cm.

Inhabits worm tubes on sand-rubble bottoms.

Depth: 1-25 m.

Southern California; the western and NE Gulf of California.

There are two subspecies, C. a. alepidota from the Gulf of California and C. alepidota californiensis, from California and northern Baja.

   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits sandy areas in worm tubes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Eastern Pacific, and has a disjunct distribution. It is found in southern California, USA and northern Baja California, Mexico and in the western and north-eastern Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continental TEP endemic, Cortez province endemic, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific Ocean from the Gulf of California to southern California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 25 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 15.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This demersal species inhabits worm tubes on sand-rubble substrate adjacent to reefs.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range ? - 11 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 2 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0.5 - 38
  Temperature range (°C): 20.794 - 23.459
  Nitrate (umol/L): 0.739 - 5.631
  Salinity (PPS): 34.936 - 35.261
  Oxygen (ml/l): 4.591 - 4.970
  Phosphate (umol/l): 0.656 - 1.098
  Silicate (umol/l): 4.734 - 12.886

Graphical representation

Depth range (m): 0.5 - 38

Temperature range (°C): 20.794 - 23.459

Nitrate (umol/L): 0.739 - 5.631

Salinity (PPS): 34.936 - 35.261

Oxygen (ml/l): 4.591 - 4.970

Phosphate (umol/l): 0.656 - 1.098

Silicate (umol/l): 4.734 - 12.886
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 11m.
Recorded at 11 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Barnacles & worm tubes, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaenopsis alepidota

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTTTTTGGTGCATGAGCTGGGATGGTCGGCACGGCTCTCAGCCTTTTAATCCGGGCCGAGCTTAGCCAACCAGGCGCTCTTTTGGGCGACGACCAAATTTATAATGTAATCGTTACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATGCCCATTCTAATTGGAGGCTTCGGTAACTGGCTCATTCCTCTTATGATCGGCGCCCCAGACATGGCCTTCCCTCGCATGAACAACATGAGTTTTTGGCTACTCCCCCCTTCTTTCCTCCTCTTACTTGCCTCCTCCGGAGTTGAGGCGGGGGCCGGTACGGGCTGAACCGTATACCCCCCTCTATCTGGGAACCTCGCCCACGCGGGCGCTTCTGTAGATCTCACCATTTTCTCTCTTCACCTGGCAGGGGTGTCCTCTATCTTAGGGGCTATCAATTTTATTACAACTATTATCAATATGAAACCCCCTGCAATTTCTCAATACCAGACACCTCTGTTCGTATGGTCGGTCCTAATTACTGCCGTCCTACTATTGCTATCCCTTCCCGTGCTGGCCGCTGGAATTACTATGCTATTAACAGACCGAAACCTAAATACCACCTTCTTTGACCCAGCAGGGGGTGGGGACCCTATTTTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaenopsis alepidota

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Bessudo, S., Dominici-Arosemena, A., Espinosa, H. & Hastings, P.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is fairly widespread in the Eastern Pacific, and is common in at least part of its range. There are no known major threats to this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is considered common in the Gulf of California.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, other than it has an intrinsically restricted and disjunct range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been recorded from several Marine Protected Areas within its range, including Loreto Bay Marine National Park, Cabo Pulmo Marine National Park, and Alto Gulfo Biosphere Reserve (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!